Transcript: Mouse XM_006507275.3

PREDICTED: Mus musculus calpain 5 (Capn5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Capn5 (12337)
Length:
4524
CDS:
253..2214

Additional Resources:

NCBI RefSeq record:
XM_006507275.3
NBCI Gene record:
Capn5 (12337)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507275.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030694 CCGGTACTTTACTGACATCAT pLKO.1 1284 CDS 100% 4.950 6.930 N Capn5 n/a
2 TRCN0000308849 CCGGTACTTTACTGACATCAT pLKO_005 1284 CDS 100% 4.950 6.930 N Capn5 n/a
3 TRCN0000030696 GCTAAGAGGAATCAGCTCTTT pLKO.1 916 CDS 100% 0.495 0.693 N Capn5 n/a
4 TRCN0000308848 GCTAAGAGGAATCAGCTCTTT pLKO_005 916 CDS 100% 0.495 0.693 N Capn5 n/a
5 TRCN0000030698 GCCAGCTCCATCTACATCAAT pLKO.1 1630 CDS 100% 5.625 3.938 N Capn5 n/a
6 TRCN0000308772 GCCAGCTCCATCTACATCAAT pLKO_005 1630 CDS 100% 5.625 3.938 N Capn5 n/a
7 TRCN0000005237 CACAGTCAACAACCAGCTCAT pLKO.1 714 CDS 100% 4.050 2.835 N CAPN5 n/a
8 TRCN0000030695 GCTCATTTACTGCCATTCCAA pLKO.1 729 CDS 100% 3.000 2.100 N Capn5 n/a
9 TRCN0000308854 GCTCATTTACTGCCATTCCAA pLKO_005 729 CDS 100% 3.000 2.100 N Capn5 n/a
10 TRCN0000030697 CCGAGTCCTGAAGGATGAATT pLKO.1 2043 CDS 100% 0.000 0.000 N Capn5 n/a
11 TRCN0000308851 CCGAGTCCTGAAGGATGAATT pLKO_005 2043 CDS 100% 0.000 0.000 N Capn5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507275.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00187 pDONR223 100% 86.2% 90.3% None (many diffs) n/a
2 ccsbBroad304_00187 pLX_304 0% 86.2% 90.3% V5 (many diffs) n/a
3 TRCN0000471227 CAGAGCTCGTCCAAAATCATGAAC pLX_317 24.6% 86.2% 90.3% V5 (many diffs) n/a
Download CSV