Transcript: Mouse XM_006507390.3

PREDICTED: Mus musculus integrin linked kinase (Ilk), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ilk (16202)
Length:
1839
CDS:
133..1587

Additional Resources:

NCBI RefSeq record:
XM_006507390.3
NBCI Gene record:
Ilk (16202)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507390.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022517 GCGACCCAAGTTTGACATGAT pLKO.1 1533 CDS 100% 4.950 3.960 N Ilk n/a
2 TRCN0000280490 GCGACCCAAGTTTGACATGAT pLKO_005 1533 CDS 100% 4.950 3.960 N Ilk n/a
3 TRCN0000022515 GCACGGATTAATGTGATGAAT pLKO.1 304 CDS 100% 5.625 3.938 N Ilk n/a
4 TRCN0000280550 GCACGGATTAATGTGATGAAT pLKO_005 304 CDS 100% 5.625 3.938 N Ilk n/a
5 TRCN0000022514 CCAAGCTGTAAAGTTTGCTTT pLKO.1 1104 CDS 100% 4.950 3.465 N Ilk n/a
6 TRCN0000280549 CCAAGCTGTAAAGTTTGCTTT pLKO_005 1104 CDS 100% 4.950 3.465 N Ilk n/a
7 TRCN0000022518 CCTGAACAAACACTCCGGTAT pLKO.1 675 CDS 100% 4.050 2.835 N Ilk n/a
8 TRCN0000280489 CCTGAACAAACACTCCGGTAT pLKO_005 675 CDS 100% 4.050 2.835 N Ilk n/a
9 TRCN0000000968 TCAGAGCTTTGTCACTTGCCA pLKO.1 1764 3UTR 100% 0.750 0.525 N ILK n/a
10 TRCN0000279854 TCAGAGCTTTGTCACTTGCCA pLKO_005 1764 3UTR 100% 0.750 0.525 N ILK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507390.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06450 pDONR223 100% 85.7% 92.9% None (many diffs) n/a
2 ccsbBroad304_06450 pLX_304 0% 85.7% 92.9% V5 (many diffs) n/a
3 TRCN0000474279 GTTTGCGACGCCATTAAGAACTAA pLX_317 38.9% 85.7% 92.9% V5 (many diffs) n/a
4 ccsbBroadEn_14673 pDONR223 0% 85.7% 92.9% None (many diffs) n/a
5 ccsbBroad304_14673 pLX_304 0% 85.7% 92.9% V5 (many diffs) n/a
6 TRCN0000472662 TCTACCGGATGAGTACTTCCCATG pLX_317 32.7% 85.7% 92.9% V5 (many diffs) n/a
7 TRCN0000488717 AAGCACACCTCCCTACCAGTGAGA pLX_317 29% 85.7% 92.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV