Transcript: Mouse XM_006507477.4

PREDICTED: Mus musculus sodium channel, nonvoltage-gated 1 gamma (Scnn1g), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Scnn1g (20278)
Length:
2704
CDS:
249..1775

Additional Resources:

NCBI RefSeq record:
XM_006507477.4
NBCI Gene record:
Scnn1g (20278)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507477.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069141 GCTTCTAATGTCATGCACGTT pLKO.1 390 CDS 100% 2.640 3.696 N Scnn1g n/a
2 TRCN0000069138 CCCGTCACAAACATCTACAAT pLKO.1 963 CDS 100% 5.625 4.500 N Scnn1g n/a
3 TRCN0000069140 CGAAGTCTTCTTCATTGATTT pLKO.1 1475 CDS 100% 13.200 9.240 N Scnn1g n/a
4 TRCN0000069142 CGTCTGTGTCATCGAAATCAT pLKO.1 1454 CDS 100% 5.625 3.938 N Scnn1g n/a
5 TRCN0000044601 CCCAGCCAACAGTATTGAGAT pLKO.1 1382 CDS 100% 4.950 3.465 N SCNN1G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507477.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01492 pDONR223 100% 66.5% 67.3% None (many diffs) n/a
2 ccsbBroad304_01492 pLX_304 0% 66.5% 67.3% V5 (many diffs) n/a
3 TRCN0000479142 CGTCCACGGCTTCAGTATCCTTCA pLX_317 21.5% 66.5% 67.3% V5 (many diffs) n/a
Download CSV