Transcript: Mouse XM_006507893.2

PREDICTED: Mus musculus ADAMTS-like 3 (Adamtsl3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adamtsl3 (269959)
Length:
7600
CDS:
511..5580

Additional Resources:

NCBI RefSeq record:
XM_006507893.2
NBCI Gene record:
Adamtsl3 (269959)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507893.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092445 GCGCCAGATGTGGAATAACAA pLKO.1 3648 CDS 100% 5.625 7.875 N Adamtsl3 n/a
2 TRCN0000092443 CCCAAATAAGTGGTCCTGTTT pLKO.1 6915 3UTR 100% 4.950 6.930 N Adamtsl3 n/a
3 TRCN0000092444 GCCTAATGTAACTTGGTTGAA pLKO.1 4536 CDS 100% 4.950 6.930 N Adamtsl3 n/a
4 TRCN0000087401 TGTGAGGGAGACTCCTATGAT pLKO.1 516 CDS 100% 5.625 3.938 N Adamtsl3 n/a
5 TRCN0000092446 CGGACACAACTCACTACTGTA pLKO.1 5551 CDS 100% 4.950 3.465 N Adamtsl3 n/a
6 TRCN0000087402 GCTATGATGACCAGACTTCAA pLKO.1 722 CDS 100% 4.950 3.465 N Adamtsl3 n/a
7 TRCN0000087398 CCTCCTATTCTTTGCGGAGAT pLKO.1 830 CDS 100% 4.050 2.835 N Adamtsl3 n/a
8 TRCN0000087399 GCCTACTTCCTTCCTGAGTTT pLKO.1 640 CDS 100% 4.950 2.970 N Adamtsl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507893.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.