Transcript: Mouse XM_006508019.2

PREDICTED: Mus musculus protein phosphatase 2, regulatory subunit B, delta (Ppp2r2d), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppp2r2d (52432)
Length:
1539
CDS:
104..970

Additional Resources:

NCBI RefSeq record:
XM_006508019.2
NBCI Gene record:
Ppp2r2d (52432)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508019.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080900 CCCACATCAGTGCAATGTATT pLKO.1 331 CDS 100% 13.200 18.480 N Ppp2r2d n/a
2 TRCN0000080902 CGGTTCAGACAGTGCCATTAT pLKO.1 679 CDS 100% 13.200 10.560 N Ppp2r2d n/a
3 TRCN0000080899 GCCACCAATAACTTGTATATA pLKO.1 929 CDS 100% 15.000 10.500 N Ppp2r2d n/a
4 TRCN0000425449 ATGCTCATACATATCACATAA pLKO_005 147 CDS 100% 13.200 9.240 N Ppp2r2d n/a
5 TRCN0000430828 ATAGTGATCATGAAACATATC pLKO_005 183 CDS 100% 10.800 7.560 N Ppp2r2d n/a
6 TRCN0000431278 GAGAATTAACCTATGGCATTT pLKO_005 220 CDS 100% 10.800 7.560 N Ppp2r2d n/a
7 TRCN0000180411 GCTGCCACCAATAACTTGTAC pLKO.1 926 CDS 100% 4.950 3.960 N PPP2R2D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508019.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03663 pDONR223 100% 56.2% 61.5% None (many diffs) n/a
2 ccsbBroad304_03663 pLX_304 0% 56.2% 61.5% V5 (many diffs) n/a
3 TRCN0000469793 TATCGACAATACAATTAAAATGTG pLX_317 25.5% 56.2% 61.5% V5 (many diffs) n/a
Download CSV