Transcript: Mouse XM_006508125.2

PREDICTED: Mus musculus ring finger protein 141 (Rnf141), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf141 (67150)
Length:
3161
CDS:
166..708

Additional Resources:

NCBI RefSeq record:
XM_006508125.2
NBCI Gene record:
Rnf141 (67150)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508125.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000349829 CGTCACCTTGGTTCGAGAAAG pLKO_005 234 CDS 100% 10.800 8.640 N Rnf141 n/a
2 TRCN0000040601 CTGTCAGAAGTGCATTGATAA pLKO.1 684 CDS 100% 13.200 9.240 N Rnf141 n/a
3 TRCN0000312889 TCATGAATTTGTACCAGTTTA pLKO_005 455 CDS 100% 13.200 9.240 N Rnf141 n/a
4 TRCN0000379328 AGTTGGTTATTAACAAGTTAC pLKO_005 194 CDS 100% 10.800 7.560 N Rnf141 n/a
5 TRCN0000040600 CTCCTTAACTTACGAAGAGTT pLKO.1 258 CDS 100% 4.950 3.465 N Rnf141 n/a
6 TRCN0000379262 CTCTGAAGAGCCTGATGAGAA pLKO_005 534 CDS 100% 4.950 3.465 N Rnf141 n/a
7 TRCN0000040602 GTAGCTGAACTCAATGATGTA pLKO.1 289 CDS 100% 4.950 3.465 N Rnf141 n/a
8 TRCN0000311907 GTAGCTGAACTCAATGATGTA pLKO_005 289 CDS 100% 4.950 3.465 N Rnf141 n/a
9 TRCN0000004179 AGGAGGAGTGTTGTATCTGTA pLKO.1 620 CDS 100% 4.950 3.465 N RNF141 n/a
10 TRCN0000279839 AGGAGGAGTGTTGTATCTGTA pLKO_005 620 CDS 100% 4.950 3.465 N RNF141 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508125.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08190 pDONR223 100% 71.4% 77.3% None (many diffs) n/a
2 ccsbBroad304_08190 pLX_304 0% 71.4% 77.3% V5 (many diffs) n/a
3 TRCN0000474540 TGGTGAACCTCGTGCATGCCCGTC pLX_317 70.7% 71.4% 77.3% V5 (many diffs) n/a
Download CSV