Transcript: Mouse XM_006508192.1

PREDICTED: Mus musculus ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (Arap1), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arap1 (69710)
Length:
5343
CDS:
464..4078

Additional Resources:

NCBI RefSeq record:
XM_006508192.1
NBCI Gene record:
Arap1 (69710)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508192.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247787 ATGGAGTTTCTACGGAATAAT pLKO_005 1862 CDS 100% 15.000 21.000 N Arap1 n/a
2 TRCN0000257673 ACGTCTCCTCTGCACTCAAAC pLKO_005 2802 CDS 100% 10.800 8.640 N Arap1 n/a
3 TRCN0000247788 GCATGTTTACTGAGCTATTTA pLKO_005 4771 3UTR 100% 15.000 10.500 N Arap1 n/a
4 TRCN0000247789 GGTGAGACTGGACGCTGATTA pLKO_005 772 CDS 100% 13.200 9.240 N Arap1 n/a
5 TRCN0000438499 GAGAACGGCTGTACCTGTTTG pLKO_005 2196 CDS 100% 10.800 7.560 N ARAP1 n/a
6 TRCN0000247786 TGGGCATTGGTATCACCTTTA pLKO_005 1152 CDS 100% 10.800 7.560 N Arap1 n/a
7 TRCN0000047834 CATGGCTTTGAGCACACCTTT pLKO.1 2159 CDS 100% 4.950 3.465 N ARAP1 n/a
8 TRCN0000047833 CCTGCGATACTTTGACAGTAA pLKO.1 793 CDS 100% 4.950 3.465 N ARAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508192.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09439 pDONR223 100% 81.5% 86.7% None (many diffs) n/a
2 ccsbBroad304_09439 pLX_304 0% 81.5% 86.7% V5 (many diffs) n/a
3 TRCN0000480589 AAATAACGGCTCGCGCACATTAAT pLX_317 10.6% 81.5% 86.7% V5 (many diffs) n/a
Download CSV