Transcript: Mouse XM_006508198.3

PREDICTED: Mus musculus CD2 antigen (cytoplasmic tail) binding protein 2 (Cd2bp2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cd2bp2 (70233)
Length:
2969
CDS:
146..1174

Additional Resources:

NCBI RefSeq record:
XM_006508198.3
NBCI Gene record:
Cd2bp2 (70233)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508198.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374919 AGGGTCCAGCAAATATGATAT pLKO_005 316 CDS 100% 13.200 9.240 N Cd2bp2 n/a
2 TRCN0000348518 CCTATTGAGAGATTCTCTTAA pLKO_005 1649 3UTR 100% 13.200 9.240 N Cd2bp2 n/a
3 TRCN0000068034 CACTCTTTAGACAGTGATGAA pLKO.1 278 CDS 100% 4.950 3.465 N Cd2bp2 n/a
4 TRCN0000068036 TGTGAGGATCACACCCTTCAA pLKO.1 394 CDS 100% 4.950 3.465 N Cd2bp2 n/a
5 TRCN0000335212 TGTGAGGATCACACCCTTCAA pLKO_005 394 CDS 100% 4.950 3.465 N Cd2bp2 n/a
6 TRCN0000068033 CCTTTGATTATTTGGGCCATT pLKO.1 2733 3UTR 100% 4.050 2.835 N Cd2bp2 n/a
7 TRCN0000068037 GTGGGAGTATAAATGGGAGAA pLKO.1 994 CDS 100% 4.050 2.835 N Cd2bp2 n/a
8 TRCN0000335136 GTGGGAGTATAAATGGGAGAA pLKO_005 994 CDS 100% 4.050 2.835 N Cd2bp2 n/a
9 TRCN0000057487 GTGTACCAGGAAACAAGGGAA pLKO.1 797 CDS 100% 2.640 1.848 N CD2BP2 n/a
10 TRCN0000068035 CCAGGAAACAAGGGAACGGTT pLKO.1 802 CDS 100% 2.640 1.584 N Cd2bp2 n/a
11 TRCN0000335213 CCAGGAAACAAGGGAACGGTT pLKO_005 802 CDS 100% 2.640 1.584 N Cd2bp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508198.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02423 pDONR223 100% 86.8% 90.3% None (many diffs) n/a
2 ccsbBroad304_02423 pLX_304 0% 86.8% 90.3% V5 (many diffs) n/a
3 TRCN0000468090 GACACATACGGTGCCATCACTAGA pLX_317 33.4% 86.8% 90.3% V5 (many diffs) n/a
Download CSV