Transcript: Mouse XM_006508604.3

PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (Ppfia1), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppfia1 (233977)
Length:
5153
CDS:
207..3947

Additional Resources:

NCBI RefSeq record:
XM_006508604.3
NBCI Gene record:
Ppfia1 (233977)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508604.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251547 AGACGACAAGACGACGATAAA pLKO_005 2498 CDS 100% 13.200 18.480 N Ppfia1 n/a
2 TRCN0000251548 GACCAACTTGTCGTGACTATT pLKO_005 1770 CDS 100% 13.200 18.480 N Ppfia1 n/a
3 TRCN0000251546 TTGGACGAGACTTTCGATTTC pLKO_005 3621 CDS 100% 10.800 15.120 N Ppfia1 n/a
4 TRCN0000251544 ATGTATATCCAGGCTATAAAT pLKO_005 4142 3UTR 100% 15.000 10.500 N Ppfia1 n/a
5 TRCN0000342548 ATGTATATCCAGGCTATAAAT pLKO_005 4142 3UTR 100% 15.000 10.500 N PPFIA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508604.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07248 pDONR223 100% 81.1% 90% None (many diffs) n/a
2 ccsbBroad304_07248 pLX_304 0% 81.1% 90% V5 (many diffs) n/a
3 TRCN0000492109 GCCTACGAGACGTCTGAGGCGCCA pLX_317 9.8% 81.1% 90% V5 (many diffs) n/a
Download CSV