Transcript: Mouse XM_006508685.3

PREDICTED: Mus musculus ankyrin repeat domain 10 (Ankrd10), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ankrd10 (102334)
Length:
2407
CDS:
256..1506

Additional Resources:

NCBI RefSeq record:
XM_006508685.3
NBCI Gene record:
Ankrd10 (102334)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508685.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085280 CGGCAAGTTGGAGTGCTTAAT pLKO.1 456 CDS 100% 13.200 9.240 N Ankrd10 n/a
2 TRCN0000085278 GCTGCATTAAATTCGTGATTT pLKO.1 2204 3UTR 100% 13.200 9.240 N Ankrd10 n/a
3 TRCN0000085279 CCCGTGCTTAACAGGATCTAA pLKO.1 1155 CDS 100% 5.625 3.938 N Ankrd10 n/a
4 TRCN0000085282 GCCTGGAAGACTCAGAATCTT pLKO.1 896 CDS 100% 5.625 3.938 N Ankrd10 n/a
5 TRCN0000085281 CCGTGTTGAATACATTGACAA pLKO.1 1061 CDS 100% 4.950 3.465 N Ankrd10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508685.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12232 pDONR223 100% 36.9% 35.2% None (many diffs) n/a
2 ccsbBroad304_12232 pLX_304 0% 36.9% 35.2% V5 (many diffs) n/a
3 TRCN0000471743 GTACTTGCGGGATATGTGTTGCAG pLX_317 68.6% 36.9% 35.2% V5 (many diffs) n/a
Download CSV