Transcript: Mouse XM_006508712.3

PREDICTED: Mus musculus mcf.2 transforming sequence-like (Mcf2l), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mcf2l (17207)
Length:
5124
CDS:
88..3639

Additional Resources:

NCBI RefSeq record:
XM_006508712.3
NBCI Gene record:
Mcf2l (17207)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508712.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110010 GCACGTTGTTTATACAACTAA pLKO.1 4282 3UTR 100% 0.563 0.450 N Mcf2l n/a
2 TRCN0000110014 GTTTGGAAACATGGAGGAAAT pLKO.1 2049 CDS 100% 10.800 7.560 N Mcf2l n/a
3 TRCN0000110011 CCAGAACTACACGGCTACATT pLKO.1 604 CDS 100% 5.625 3.938 N Mcf2l n/a
4 TRCN0000110013 GCTGATTGAGAACAGGCACTA pLKO.1 1254 CDS 100% 4.050 2.835 N Mcf2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508712.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11708 pDONR223 100% 71% 72.3% None (many diffs) n/a
2 ccsbBroad304_11708 pLX_304 0% 71% 72.3% V5 (many diffs) n/a
3 TRCN0000467665 TTAGCTTTGATTCAATATCGGCAC pLX_317 12.1% 71% 72.3% V5 (many diffs) n/a
Download CSV