Transcript: Mouse XM_006508754.1

PREDICTED: Mus musculus transcription factor Dp 1 (Tfdp1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tfdp1 (21781)
Length:
2688
CDS:
657..1529

Additional Resources:

NCBI RefSeq record:
XM_006508754.1
NBCI Gene record:
Tfdp1 (21781)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508754.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075514 GCGTGTCTACGATGCCTTAAA pLKO.1 797 CDS 100% 13.200 18.480 N Tfdp1 n/a
2 TRCN0000075515 CGATGCCTTAAATGTGCTAAT pLKO.1 806 CDS 100% 10.800 7.560 N Tfdp1 n/a
3 TRCN0000374227 GGATCCATTGGTGGAGTATTC pLKO_005 1314 CDS 100% 10.800 7.560 N Tfdp1 n/a
4 TRCN0000304311 CCACATTCTACCAAACGAATC pLKO_005 749 CDS 100% 6.000 4.200 N Tfdp1 n/a
5 TRCN0000310865 GCTGCCGACAACCACATTCTA pLKO_005 738 CDS 100% 5.625 3.938 N Tfdp1 n/a
6 TRCN0000075517 CCTGCAGCAAATTGCCTTCAA pLKO.1 977 CDS 100% 4.950 3.465 N Tfdp1 n/a
7 TRCN0000301409 CCTGCAGCAAATTGCCTTCAA pLKO_005 977 CDS 100% 4.950 3.465 N Tfdp1 n/a
8 TRCN0000075516 CCAGAATCTTAGTCCTGGGAA pLKO.1 250 5UTR 100% 2.640 1.848 N Tfdp1 n/a
9 TRCN0000075513 GCAGAGCCTCTATCTACCTTT pLKO.1 1742 3UTR 100% 4.950 2.970 N Tfdp1 n/a
10 TRCN0000331726 GCAGAGCCTCTATCTACCTTT pLKO_005 1742 3UTR 100% 4.950 2.970 N Tfdp1 n/a
11 TRCN0000374166 AGGAGAAGAAGGAGATCAAAT pLKO_005 847 CDS 100% 13.200 6.600 Y Tfdp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508754.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07051 pDONR223 100% 61.1% 66.8% None (many diffs) n/a
2 ccsbBroad304_07051 pLX_304 0% 61.1% 66.8% V5 (many diffs) n/a
3 TRCN0000480469 GTACCTAAGAGCTGAAACTACTCG pLX_317 22.1% 61.1% 66.8% V5 (many diffs) n/a
Download CSV