Construct: ORF TRCN0000480469
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008746.1_s317c1
- Derived from:
- ccsbBroadEn_07051
- DNA Barcode:
- GTACCTAAGAGCTGAAACTACTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TFDP1 (7027)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480469
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7027 | TFDP1 | transcription factor Dp-1 | NM_007111.5 | 99.6% | 99.2% | (many diffs) |
| 2 | human | 7027 | TFDP1 | transcription factor Dp-1 | XM_005268327.1 | 99.6% | 99.2% | (many diffs) |
| 3 | human | 7027 | TFDP1 | transcription factor Dp-1 | XM_005268328.2 | 98.7% | 98.2% | (many diffs) |
| 4 | human | 7027 | TFDP1 | transcription factor Dp-1 | XM_017020718.1 | 98.7% | 98.2% | (many diffs) |
| 5 | human | 7027 | TFDP1 | transcription factor Dp-1 | XM_017020717.1 | 85.8% | 85.5% | (many diffs) |
| 6 | human | 51270 | TFDP3 | transcription factor Dp fam... | NM_016521.3 | 85.1% | 74.4% | (many diffs) |
| 7 | human | 7027 | TFDP1 | transcription factor Dp-1 | XM_017020719.2 | 81.9% | 81.4% | (many diffs) |
| 8 | human | 7027 | TFDP1 | transcription factor Dp-1 | XM_017020720.2 | 76.6% | 74.8% | (many diffs) |
| 9 | human | 7027 | TFDP1 | transcription factor Dp-1 | XM_017020721.1 | 76.6% | 74.8% | (many diffs) |
| 10 | human | 7027 | TFDP1 | transcription factor Dp-1 | XM_024449405.1 | 75.6% | 73.9% | (many diffs) |
| 11 | human | 7027 | TFDP1 | transcription factor Dp-1 | XM_011537519.1 | 65.9% | 64.4% | (many diffs) |
| 12 | human | 7027 | TFDP1 | transcription factor Dp-1 | XM_011537520.2 | 65.9% | 64.4% | (many diffs) |
| 13 | human | 7027 | TFDP1 | transcription factor Dp-1 | XM_024449404.1 | 65.9% | 64.4% | (many diffs) |
| 14 | human | 7027 | TFDP1 | transcription factor Dp-1 | XM_017020722.2 | 58.8% | 57% | (many diffs) |
| 15 | human | 7027 | TFDP1 | transcription factor Dp-1 | NR_026580.1 | 42.9% | (many diffs) | |
| 16 | mouse | 21781 | Tfdp1 | transcription factor Dp 1 | NM_001291765.1 | 86.6% | 94.1% | (many diffs) |
| 17 | mouse | 21781 | Tfdp1 | transcription factor Dp 1 | NM_009361.3 | 86.6% | 94.1% | (many diffs) |
| 18 | mouse | 21781 | Tfdp1 | transcription factor Dp 1 | XM_006508751.3 | 86.6% | 94.1% | (many diffs) |
| 19 | mouse | 21781 | Tfdp1 | transcription factor Dp 1 | XM_017312657.1 | 86.2% | 93.6% | (many diffs) |
| 20 | mouse | 21781 | Tfdp1 | transcription factor Dp 1 | XM_017312658.1 | 86.2% | 93.6% | (many diffs) |
| 21 | mouse | 21781 | Tfdp1 | transcription factor Dp 1 | XM_017312659.1 | 86.2% | 93.6% | (many diffs) |
| 22 | mouse | 21781 | Tfdp1 | transcription factor Dp 1 | NM_001291766.1 | 61.1% | 66.8% | (many diffs) |
| 23 | mouse | 21781 | Tfdp1 | transcription factor Dp 1 | NM_001291768.1 | 61.1% | 66.8% | (many diffs) |
| 24 | mouse | 21781 | Tfdp1 | transcription factor Dp 1 | XM_006508754.1 | 61.1% | 66.8% | (many diffs) |
| 25 | mouse | 21781 | Tfdp1 | transcription factor Dp 1 | XM_006508755.1 | 61.1% | 66.8% | (many diffs) |
| 26 | mouse | 21781 | Tfdp1 | transcription factor Dp 1 | XM_006508758.3 | 61.1% | 66.8% | (many diffs) |
| 27 | mouse | 21781 | Tfdp1 | transcription factor Dp 1 | XM_011242048.1 | 61.1% | 66.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1296
- ORF length:
- 1230
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc agaagatgcc ggtctaattg aagccaacgg agaactcaag gtcttcatag 121 accagaacct tagtcccggg aaaggcgtgg tgtccctcgt ggccgttcac ccctccaccg 181 tcaacccgct cgggaagcag ctcttgccaa aaacctttgg acagtccaat gtcaacattg 241 cccagcaagt ggtaattggt acgcctcaga gaccggcagc gtcaaacacc ctggtggtag 301 gaagcccaca cacccccagc actcactttg cctctcagaa ccagccttcc gactcctcac 361 cttggtctgc cgggaagcgc aacaggaaag gagagaagaa tggcaagggc ctacggcatt 421 tctccatgaa ggtctgcgag aaggtgcaga ggaaagggac cacttcctac aacgaagtgg 481 cagacgagct ggttgcggag ttcagtgctg ccgacaacca catcttacca aacgagtcag 541 cttatgacca gaaaaacata agacggcgcg tctacgatgc cttaaacgtg ctaatggcca 601 tgaacatcat ctccaaggag aagaaggaga tcaagtggat tggtctgccc accaactcgg 661 ctcaggaatg tcagaactta gaggtggaaa gacagaggag acttgaaaga ataaaacaga 721 aacagtctca acttcaagaa cttattctac agcaaattgc cttcaagaac ctggtgcaga 781 gaaaccggca tgcggagcag caggccagcc ggccaccgcc acccaactca gtcatccacc 841 tgcccttcat catcgtcaac accagcaaga agacggtcat cgactgcagc atctccaatg 901 acaaatttga gtatctgttt aattttgaca acacatttga aatccacgat gacatagaag 961 tgctgaagcg gatgggcatg gcttgcgggc tggagtcggg gagctgctct gccgaagacc 1021 ttaaaatggC CAGAAGTCTG GTCCCCAAGG CTCTGGAGCC ATACGTGACA GAAATGGCTC 1081 AGGGAACTGT TGGAGGCGTG TTCATCACGA CGGCAGGTTC CACGTCTAAC GGCACAAGGT 1141 TCTCTGCCAG TGACCTGACC AACGGTGCAG ATGGGATGCT GGCCACAAGC TCCAATGGGT 1201 CTCAGTACAG CGGCTCCAGG GTGGAGACTC CGGTGTCCTA CGTCGGGGAG GACGACGAGG 1261 AGGACGATGA CTTCAACGAG AATGACGACG ACGCGTGCCC AACTTTCTTG TACAAAGTGG 1321 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1381 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1441 AGTACCTAAG AGCTGAAACT ACTCGACGCG TTAAGTCgac aatcaacctc tggattacaa 1501 aatttgtgaa agatt