Transcript: Mouse XM_006509147.3

PREDICTED: Mus musculus transforming, acidic coiled-coil containing protein 1 (Tacc1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tacc1 (320165)
Length:
6390
CDS:
219..1190

Additional Resources:

NCBI RefSeq record:
XM_006509147.3
NBCI Gene record:
Tacc1 (320165)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509147.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126703 CGTTGATCAGAGAAGAGATAA pLKO.1 595 CDS 100% 13.200 10.560 N Tacc1 n/a
2 TRCN0000126700 CGAAGCAAATGAATGGAAGAA pLKO.1 629 CDS 100% 4.950 3.960 N Tacc1 n/a
3 TRCN0000126702 CACGTTGATCAGAGAAGAGAT pLKO.1 593 CDS 100% 4.950 3.465 N Tacc1 n/a
4 TRCN0000126701 GCATGAGTTCTCAGAAGAGTT pLKO.1 751 CDS 100% 4.950 3.465 N Tacc1 n/a
5 TRCN0000126699 GCCAAGTGTTTATTGCACATT pLKO.1 6066 3UTR 100% 4.950 3.465 N Tacc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509147.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11168 pDONR223 100% 38% 39.5% None (many diffs) n/a
2 ccsbBroad304_11168 pLX_304 0% 38% 39.5% V5 (many diffs) n/a
3 TRCN0000478540 TGCCTAACGCTTCCGTTGCCGGAC pLX_317 16.1% 38% 39.5% V5 (many diffs) n/a
Download CSV