Transcript: Mouse XM_006509223.3

PREDICTED: Mus musculus adhesion G protein-coupled receptor A2 (Adgra2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adgra2 (78560)
Length:
5752
CDS:
328..4362

Additional Resources:

NCBI RefSeq record:
XM_006509223.3
NBCI Gene record:
Adgra2 (78560)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509223.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012028 GCCATGCTAATAATCTGACTT pLKO.1 5225 3UTR 100% 4.950 6.930 N Adgra2 n/a
2 TRCN0000350174 GCCATGCTAATAATCTGACTT pLKO_005 5225 3UTR 100% 4.950 6.930 N Adgra2 n/a
3 TRCN0000012032 CCCTAGACTTCTCAGACTAAA pLKO.1 918 CDS 100% 13.200 9.240 N Adgra2 n/a
4 TRCN0000314231 CCCTAGACTTCTCAGACTAAA pLKO_005 918 CDS 100% 13.200 9.240 N Adgra2 n/a
5 TRCN0000012031 GCTGAACCTTTGTTTCCATAT pLKO.1 2871 CDS 100% 10.800 7.560 N Adgra2 n/a
6 TRCN0000314172 GCTGAACCTTTGTTTCCATAT pLKO_005 2871 CDS 100% 10.800 7.560 N Adgra2 n/a
7 TRCN0000012029 CGCTCAACACTACCAGTCTTA pLKO.1 4232 CDS 100% 4.950 3.465 N Adgra2 n/a
8 TRCN0000350114 CGCTCAACACTACCAGTCTTA pLKO_005 4232 CDS 100% 4.950 3.465 N Adgra2 n/a
9 TRCN0000012030 GCCTATCACCTGGATCTACTT pLKO.1 3255 CDS 100% 4.950 3.465 N Adgra2 n/a
10 TRCN0000314233 GCCTATCACCTGGATCTACTT pLKO_005 3255 CDS 100% 4.950 3.465 N Adgra2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509223.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492170 GAGTTACTAGGCCCCGACTTGTTA pLX_317 12.3% 66.5% 69.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV