Transcript: Mouse XM_006509243.3

PREDICTED: Mus musculus sorting nexin 25 (Snx25), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Snx25 (102141)
Length:
3270
CDS:
272..2794

Additional Resources:

NCBI RefSeq record:
XM_006509243.3
NBCI Gene record:
Snx25 (102141)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509243.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253172 ACGTACAATGCTCGCAGAAAT pLKO_005 649 CDS 100% 13.200 18.480 N Snx25 n/a
2 TRCN0000192116 CGCAGAAATTCTTACGACAAA pLKO.1 661 CDS 100% 4.950 6.930 N Snx25 n/a
3 TRCN0000253169 ATGGGTGCGAAGAACATTAAT pLKO_005 2371 CDS 100% 15.000 10.500 N Snx25 n/a
4 TRCN0000253168 TACAGTTACAGAGACTATATT pLKO_005 302 CDS 100% 15.000 10.500 N Snx25 n/a
5 TRCN0000192115 CCAGAGAAATGTCTGTGTAAA pLKO.1 2813 3UTR 100% 13.200 9.240 N Snx25 n/a
6 TRCN0000253170 CAGATGCTGTGGTAGGCAATA pLKO_005 2951 3UTR 100% 10.800 7.560 N Snx25 n/a
7 TRCN0000200713 GCTCTAAGTTCTATTCAGAAT pLKO.1 1652 CDS 100% 4.950 3.465 N Snx25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509243.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14299 pDONR223 100% 56.2% 56.8% None (many diffs) n/a
2 ccsbBroad304_14299 pLX_304 0% 56.2% 56.8% V5 (many diffs) n/a
3 TRCN0000476385 CTGCAAATATAGATCAGTGTTTCA pLX_317 21.7% 56.2% 56.8% V5 (many diffs) n/a
Download CSV