Transcript: Mouse XM_006509252.3

PREDICTED: Mus musculus solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 (Slc7a2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc7a2 (11988)
Length:
8002
CDS:
427..2466

Additional Resources:

NCBI RefSeq record:
XM_006509252.3
NBCI Gene record:
Slc7a2 (11988)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509252.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079375 CGTCCTTACTTGTCTGCTTTA pLKO.1 1370 CDS 100% 10.800 7.560 N Slc7a2 n/a
2 TRCN0000042974 GCTGGGTTTGTGAAAGGAAAT pLKO.1 1111 CDS 100% 10.800 7.560 N SLC7A2 n/a
3 TRCN0000079374 CGGCCTTTGCTATGCTGAATT pLKO.1 735 CDS 100% 0.000 0.000 N Slc7a2 n/a
4 TRCN0000116737 CCTCCCAAGTAGCTGGAATTA pLKO.1 3776 3UTR 100% 13.200 7.920 N CLDN18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509252.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11137 pDONR223 100% 81% 85.7% None (many diffs) n/a
2 ccsbBroad304_11137 pLX_304 0% 81% 85.7% V5 (many diffs) n/a
3 TRCN0000469007 ATGGTTTTTCTGTATGTTAGTTCC pLX_317 18.9% 81% 85.7% V5 (many diffs) n/a
Download CSV