Transcript: Mouse XM_006509444.3

PREDICTED: Mus musculus ectonucleotide pyrophosphatase/phosphodiesterase 6 (Enpp6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Enpp6 (320981)
Length:
4762
CDS:
461..1603

Additional Resources:

NCBI RefSeq record:
XM_006509444.3
NBCI Gene record:
Enpp6 (320981)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509444.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081041 GCGATGCTCTCGACTCATTAA pLKO.1 792 CDS 100% 13.200 18.480 N Enpp6 n/a
2 TRCN0000081039 CGGATATGACAACGAACTCAT pLKO.1 1342 CDS 100% 4.950 6.930 N Enpp6 n/a
3 TRCN0000081038 GCCGTTAAAGTTGTGAATATA pLKO.1 1710 3UTR 100% 15.000 10.500 N Enpp6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509444.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04882 pDONR223 100% 72.3% 70.8% None (many diffs) n/a
2 ccsbBroad304_04882 pLX_304 0% 72.3% 70.8% V5 (many diffs) n/a
3 TRCN0000475058 CGATATTCTATAAACCACCCGGAG pLX_317 27.6% 72.3% 70.8% V5 (many diffs) n/a
Download CSV