Transcript: Mouse XM_006509524.2

PREDICTED: Mus musculus high mobility group box 2 (Hmgb2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hmgb2 (97165)
Length:
1175
CDS:
179..811

Additional Resources:

NCBI RefSeq record:
XM_006509524.2
NBCI Gene record:
Hmgb2 (97165)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509524.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431522 ATGTCCTCGTACGCCTTCTTC pLKO_005 215 CDS 100% 4.950 2.970 N HMGB2 n/a
2 TRCN0000092928 GCTACAACTACAGTTAGATTT pLKO.1 988 3UTR 100% 13.200 6.600 Y Gm13237 n/a
3 TRCN0000304269 AGAGCGACAAAGCTCGTTATG pLKO_005 372 CDS 100% 10.800 5.400 Y Hmgb2 n/a
4 TRCN0000304268 TTGGAGATACTGCGAAGAAAC pLKO_005 543 CDS 100% 10.800 5.400 Y Hmgb2 n/a
5 TRCN0000092880 CTGAGCAATCTGCCAAAGATA pLKO.1 579 CDS 100% 5.625 2.813 Y Gm4169 n/a
6 TRCN0000092879 GACAGGGAGATGAAGAACTAT pLKO.1 392 CDS 100% 5.625 2.813 Y Gm4169 n/a
7 TRCN0000075585 GCTAAACTAAAGGAGAAGTAT pLKO.1 623 CDS 100% 5.625 2.813 Y Hmgb2 n/a
8 TRCN0000310863 TAGGCCAACAGGCTCAAAGAA pLKO_005 706 CDS 100% 5.625 2.813 Y Hmgb2 n/a
9 TRCN0000092882 CAAGAGCGACAAAGCTCGTTA pLKO.1 370 CDS 100% 4.950 2.475 Y Gm4169 n/a
10 TRCN0000092941 CAGGCCTGTCTATTGGAGATA pLKO.1 531 CDS 100% 4.950 2.475 Y Gm13232 n/a
11 TRCN0000075586 CCAAGAAATGCTCCGAGAGAT pLKO.1 303 CDS 100% 4.950 2.475 Y Hmgb2 n/a
12 TRCN0000092930 CCGTCTGCCTTCTTCCTGTTT pLKO.1 473 CDS 100% 4.950 2.475 Y Gm13237 n/a
13 TRCN0000092942 GAAGATGAGGAGGAGGAAGAA pLKO.1 740 CDS 100% 4.950 2.475 Y Gm13232 n/a
14 TRCN0000075587 GAGGAAGAAGAGGAGGATGAA pLKO.1 785 CDS 100% 4.950 2.475 Y Hmgb2 n/a
15 TRCN0000173568 GAGGAAGAAGAGGAGGATGAA pLKO.1 785 CDS 100% 4.950 2.475 Y Chic1 n/a
16 TRCN0000301335 GAGGAAGAAGAGGAGGATGAA pLKO_005 785 CDS 100% 4.950 2.475 Y Hmgb2 n/a
17 TRCN0000092938 GATGAGATTCTTTGTAGAGAA pLKO.1 931 3UTR 100% 4.950 2.475 Y Gm13232 n/a
18 TRCN0000092932 GCCAACAGGCTCAAAGAAGAA pLKO.1 709 CDS 100% 4.950 2.475 Y Gm13237 n/a
19 TRCN0000075583 GCTCAACATTAGCTTCAGTAT pLKO.1 883 3UTR 100% 4.950 2.475 Y Hmgb2 n/a
20 TRCN0000301407 GCTCAACATTAGCTTCAGTAT pLKO_005 883 3UTR 100% 4.950 2.475 Y Hmgb2 n/a
21 TRCN0000075584 GCCAAAGATAAACAACCGTAT pLKO.1 590 CDS 100% 4.050 2.025 Y Hmgb2 n/a
22 TRCN0000092878 GCTGTCCTAAAGTGTGGAGTA pLKO.1 815 3UTR 100% 4.050 2.025 Y Gm4169 n/a
23 TRCN0000092940 GAAGAACTATGTTCCTCCCAA pLKO.1 403 CDS 100% 2.640 1.320 Y Gm13232 n/a
24 TRCN0000092931 CAACCGTATGAGCAGAAAGTA pLKO.1 602 CDS 100% 5.625 2.813 Y Gm13237 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509524.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00751 pDONR223 100% 89.8% 96.6% None (many diffs) n/a
2 ccsbBroad304_00751 pLX_304 0% 89.8% 96.6% V5 (many diffs) n/a
3 TRCN0000472051 TCGTGCCCACAAAACATGTAAAGT pLX_317 56.4% 89.8% 96.6% V5 (many diffs) n/a
Download CSV