Transcript: Mouse XM_006509546.3

PREDICTED: Mus musculus epidermal growth factor receptor pathway substrate 15-like 1 (Eps15l1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eps15l1 (13859)
Length:
3118
CDS:
102..2732

Additional Resources:

NCBI RefSeq record:
XM_006509546.3
NBCI Gene record:
Eps15l1 (13859)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509546.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295306 TCCCGGTGGAAATCCGTTATA pLKO_005 137 CDS 100% 13.200 18.480 N Eps15l1 n/a
2 TRCN0000111554 CCTTCAAAGCTCGACCCATTT pLKO.1 2097 CDS 100% 10.800 15.120 N Eps15l1 n/a
3 TRCN0000307512 TTAGTGGCAAAGATCCATTTG pLKO_005 2506 CDS 100% 10.800 15.120 N Eps15l1 n/a
4 TRCN0000111551 GCAGATAAGATGCGCTTTGAT pLKO.1 915 CDS 100% 5.625 4.500 N Eps15l1 n/a
5 TRCN0000287949 GCAGATAAGATGCGCTTTGAT pLKO_005 915 CDS 100% 5.625 4.500 N Eps15l1 n/a
6 TRCN0000111550 CATCCCTTCAAGTTGTGCCAT pLKO.1 2765 3UTR 100% 2.640 2.112 N Eps15l1 n/a
7 TRCN0000287878 CATCCCTTCAAGTTGTGCCAT pLKO_005 2765 3UTR 100% 2.640 2.112 N Eps15l1 n/a
8 TRCN0000111552 CCAGACAATCTCATCATTGAA pLKO.1 1517 CDS 100% 5.625 3.938 N Eps15l1 n/a
9 TRCN0000111553 GCTGCGCTGTTTCTGAAGAAA pLKO.1 216 CDS 100% 5.625 3.938 N Eps15l1 n/a
10 TRCN0000287951 GCTGCGCTGTTTCTGAAGAAA pLKO_005 216 CDS 100% 5.625 3.938 N Eps15l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509546.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12417 pDONR223 100% 68.5% 73.9% None (many diffs) n/a
2 ccsbBroad304_12417 pLX_304 0% 68.5% 73.9% V5 (many diffs) n/a
3 TRCN0000475127 TACCTGGATAGTCCGAACTCCGGC pLX_317 17.1% 68.5% 73.9% V5 (many diffs) n/a
4 ccsbBroadEn_12418 pDONR223 100% 58.3% 59.9% None (many diffs) n/a
5 ccsbBroad304_12418 pLX_304 0% 58.3% 59.9% V5 (many diffs) n/a
6 TRCN0000475982 TTCACTGTACTAGCTTGCTTTCTC pLX_317 15.1% 58.3% 59.9% V5 (many diffs) n/a
Download CSV