Transcript: Mouse XM_006509676.3

PREDICTED: Mus musculus solute carrier family 27 (fatty acid transporter), member 1 (Slc27a1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc27a1 (26457)
Length:
3338
CDS:
153..2093

Additional Resources:

NCBI RefSeq record:
XM_006509676.3
NBCI Gene record:
Slc27a1 (26457)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509676.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070263 CGGCGTTTCGATGGTTATGTT pLKO.1 1533 CDS 100% 5.625 7.875 N Slc27a1 n/a
2 TRCN0000420136 CTCAGGTGACGTGCTAGTGAT pLKO_005 1619 CDS 100% 4.950 3.465 N SLC27A1 n/a
3 TRCN0000038186 AGGCACCTTCAAGATCCAGAA pLKO.1 1934 CDS 100% 4.050 2.835 N SLC27A1 n/a
4 TRCN0000070264 CTCTCTGTTCTGATTCGTGTT pLKO.1 324 CDS 100% 4.050 2.835 N Slc27a1 n/a
5 TRCN0000070267 CTGCTTTGGTTTCTGGGACTT pLKO.1 198 CDS 100% 4.050 2.835 N Slc27a1 n/a
6 TRCN0000070266 GCTCTTCTTTCTAGACCTGAA pLKO.1 2003 CDS 100% 4.050 2.835 N Slc27a1 n/a
7 TRCN0000070265 CCTAACTCAATGTACCAGGAA pLKO.1 1845 CDS 100% 2.640 1.848 N Slc27a1 n/a
8 TRCN0000038188 CATTGCCAACATGGACGGCAA pLKO.1 1337 CDS 100% 0.216 0.151 N SLC27A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509676.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489207 GATACCGTAGCAGTACGCCACGAT pLX_317 17.3% 84.5% 89.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV