Transcript: Mouse XM_006509939.2

PREDICTED: Mus musculus family with sequence similarity 118, member B (Fam118b), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam118b (109229)
Length:
882
CDS:
98..826

Additional Resources:

NCBI RefSeq record:
XM_006509939.2
NBCI Gene record:
Fam118b (109229)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148569 CCAGTAATGTTCGATCCACAT pLKO.1 441 CDS 100% 4.050 5.670 N FAM118B n/a
2 TRCN0000182034 CGAGAACTTGTGCTGGTGATT pLKO.1 218 CDS 100% 4.950 3.960 N Fam118b n/a
3 TRCN0000217818 CTTACTGGATGCTGCTATTGA pLKO.1 310 CDS 100% 5.625 3.938 N Fam118b n/a
4 TRCN0000130258 CCTTGACCTTACTGATGAGAA pLKO.1 640 CDS 100% 4.950 3.465 N FAM118B n/a
5 TRCN0000176987 GTCAAGCATAAATCTGACCTA pLKO.1 832 3UTR 100% 2.640 1.848 N Fam118b n/a
6 TRCN0000279484 GTCAAGCATAAATCTGACCTA pLKO_005 832 3UTR 100% 2.640 1.848 N Fam118b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04088 pDONR223 100% 63% 64.4% None (many diffs) n/a
2 ccsbBroad304_04088 pLX_304 0% 63% 64.4% V5 (many diffs) n/a
3 TRCN0000471505 GCTAAGCCCAAGAACTTAACACGT pLX_317 47.9% 63% 64.4% V5 (many diffs) n/a
Download CSV