Transcript: Mouse XM_006509970.3

PREDICTED: Mus musculus crystallin, alpha B (Cryab), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cryab (12955)
Length:
976
CDS:
308..835

Additional Resources:

NCBI RefSeq record:
XM_006509970.3
NBCI Gene record:
Cryab (12955)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509970.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097213 GTCCACGGCAAGCACGAAGAA pLKO.1 605 CDS 100% 1.650 2.310 N Cryab n/a
2 TRCN0000317168 GTCCACGGCAAGCACGAAGAA pLKO_005 605 CDS 100% 1.650 2.310 N Cryab n/a
3 TRCN0000097210 CCATCACTTCATCCCTGTCAT pLKO.1 702 CDS 100% 4.950 3.465 N Cryab n/a
4 TRCN0000349509 CCATCACTTCATCCCTGTCAT pLKO_005 702 CDS 100% 4.950 3.465 N Cryab n/a
5 TRCN0000097212 TCACTGTGAATGGACCAAGGA pLKO.1 735 CDS 100% 2.640 1.848 N Cryab n/a
6 TRCN0000317169 TCACTGTGAATGGACCAAGGA pLKO_005 735 CDS 100% 2.640 1.848 N Cryab n/a
7 TRCN0000097209 CCGGACTCTCAGAGATGCGTT pLKO.1 495 CDS 100% 0.880 0.616 N Cryab n/a
8 TRCN0000317167 CCGGACTCTCAGAGATGCGTT pLKO_005 495 CDS 100% 0.880 0.616 N Cryab n/a
9 TRCN0000010823 CCGTGAAGAGAAGCCTGCTGT pLKO.1 793 CDS 100% 0.880 0.616 N CRYAB n/a
10 TRCN0000097211 GCGTTTGGAGAAGGACAGATT pLKO.1 511 CDS 100% 4.950 2.970 N Cryab n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509970.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06042 pDONR223 100% 91% 97.7% None (many diffs) n/a
2 ccsbBroad304_06042 pLX_304 0% 91% 97.7% V5 (many diffs) n/a
3 TRCN0000480151 ATTACTATCTTGTGATTCGACGGA pLX_317 71.7% 91% 97.7% V5 (many diffs) n/a
Download CSV