Transcript: Mouse XM_006510206.3

PREDICTED: Mus musculus neurotrimin (Ntm), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ntm (235106)
Length:
3448
CDS:
561..1664

Additional Resources:

NCBI RefSeq record:
XM_006510206.3
NBCI Gene record:
Ntm (235106)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510206.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113596 CGTGAACTATCCACCATACAT pLKO.1 1214 CDS 100% 5.625 7.875 N Ntm n/a
2 TRCN0000161782 CGTGAACTATCCACCATACAT pLKO.1 1214 CDS 100% 5.625 7.875 N NTM n/a
3 TRCN0000113595 CCCAAATTTCATCGGTCCATA pLKO.1 2043 3UTR 100% 4.950 6.930 N Ntm n/a
4 TRCN0000113597 CAATTCTATCTCGTGGGCAAT pLKO.1 587 CDS 100% 4.050 3.240 N Ntm n/a
5 TRCN0000113599 CAATGGTTCAAGGATGACAAA pLKO.1 1320 CDS 100% 4.950 3.465 N Ntm n/a
6 TRCN0000113598 CCTACAGTAACCTGGAGACAT pLKO.1 1053 CDS 100% 4.950 3.465 N Ntm n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510206.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08191 pDONR223 100% 73.9% 76.4% None (many diffs) n/a
2 ccsbBroad304_08191 pLX_304 0% 73.9% 76.4% V5 (many diffs) n/a
3 TRCN0000467633 TGAACTCCATTTGGGGCGGGAACC pLX_317 41.5% 73.9% 76.4% V5 (many diffs) n/a
Download CSV