Transcript: Mouse XM_006510235.3

PREDICTED: Mus musculus GRAM domain containing 1B (Gramd1b), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gramd1b (235283)
Length:
8857
CDS:
1410..4100

Additional Resources:

NCBI RefSeq record:
XM_006510235.3
NBCI Gene record:
Gramd1b (235283)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510235.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419783 GACGAAAGCACTGCCAGTAAC pLKO_005 1854 CDS 100% 10.800 15.120 N Gramd1b n/a
2 TRCN0000192523 GATGAAGGACTCGCTTATCAA pLKO.1 4010 CDS 100% 5.625 7.875 N Gramd1b n/a
3 TRCN0000200574 CTCGCTTATCAATCTTCAGAA pLKO.1 4019 CDS 100% 4.950 6.930 N Gramd1b n/a
4 TRCN0000200972 CCCACTTACAAGCAGAGAAAT pLKO.1 2148 CDS 100% 13.200 9.240 N Gramd1b n/a
5 TRCN0000425778 GAGGACTACTTCCGTCATTTA pLKO_005 3456 CDS 100% 13.200 9.240 N Gramd1b n/a
6 TRCN0000443517 GAAACCAGAGTCGAGTGATTC pLKO_005 3148 CDS 100% 10.800 7.560 N Gramd1b n/a
7 TRCN0000200947 CAGGACGTACATGATGATGTT pLKO.1 2453 CDS 100% 4.950 3.465 N Gramd1b n/a
8 TRCN0000200720 GCCTCATTGTTGATTACTCTT pLKO.1 2212 CDS 100% 4.950 3.465 N Gramd1b n/a
9 TRCN0000190630 GCTCTTCTACAAGCTGTGGAT pLKO.1 3815 CDS 100% 2.640 1.848 N Gramd1b n/a
10 TRCN0000136423 CTGCTTCTACAGCAACATCTT pLKO.1 2291 CDS 100% 4.950 2.970 N GRAMD1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510235.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08735 pDONR223 100% 74.7% 79.2% None (many diffs) n/a
2 ccsbBroad304_08735 pLX_304 0% 74.7% 79.2% V5 (many diffs) n/a
3 TRCN0000465695 GACTAAAGGTCGTCCTACCGATTA pLX_317 16.2% 74.7% 79.2% V5 (many diffs) n/a
4 ccsbBroadEn_08736 pDONR223 100% 74.7% 79.2% None (many diffs) n/a
5 ccsbBroad304_08736 pLX_304 0% 74.7% 79.2% V5 (many diffs) n/a
6 TRCN0000481176 CCCAACGGCCCCACGATTGATAAG pLX_317 18.1% 74.7% 79.2% V5 (many diffs) n/a
Download CSV