Transcript: Mouse XM_006510415.3

PREDICTED: Mus musculus Bardet-Biedl syndrome 9 (human) (Bbs9), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bbs9 (319845)
Length:
3561
CDS:
514..3171

Additional Resources:

NCBI RefSeq record:
XM_006510415.3
NBCI Gene record:
Bbs9 (319845)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510415.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336349 AGTGGGAACGGCCACGATAAA pLKO_005 610 CDS 100% 13.200 18.480 N Bbs9 n/a
2 TRCN0000178683 CTTTAGTCACATGCGCTTATA pLKO.1 3390 3UTR 100% 13.200 18.480 N Bbs9 n/a
3 TRCN0000336346 CTTTAGTCACATGCGCTTATA pLKO_005 3390 3UTR 100% 13.200 18.480 N Bbs9 n/a
4 TRCN0000336347 GCAAGCCACAAACTAACTATA pLKO_005 2140 CDS 100% 13.200 18.480 N Bbs9 n/a
5 TRCN0000182069 CCTTTAGTCACATGCGCTTAT pLKO.1 3389 3UTR 100% 10.800 15.120 N Bbs9 n/a
6 TRCN0000182387 GCCTTTAGTCACATGCGCTTA pLKO.1 3388 3UTR 100% 4.050 5.670 N Bbs9 n/a
7 TRCN0000336348 CATGAAGAAGCTCGGTTATAA pLKO_005 1350 CDS 100% 15.000 10.500 N Bbs9 n/a
8 TRCN0000215917 CATAACCACATGCTGCATATT pLKO.1 1435 CDS 100% 13.200 9.240 N Bbs9 n/a
9 TRCN0000176650 CTAACTATAGACACCAACAAA pLKO.1 2152 CDS 100% 5.625 3.938 N Bbs9 n/a
10 TRCN0000198597 CTTGCAGACAAGTGGAAAGTT pLKO.1 1106 CDS 100% 5.625 3.938 N Bbs9 n/a
11 TRCN0000181485 CCACTACAGTTGACTTGTGAT pLKO.1 1900 CDS 100% 4.950 3.465 N Bbs9 n/a
12 TRCN0000353326 CCACTACAGTTGACTTGTGAT pLKO_005 1900 CDS 100% 4.950 3.465 N Bbs9 n/a
13 TRCN0000182647 GCTGTGTGATAGGTTAGCCAA pLKO.1 2952 CDS 100% 2.640 1.848 N Bbs9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510415.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15790 pDONR223 0% 29.9% 30.5% None (many diffs) n/a
2 ccsbBroad304_15790 pLX_304 0% 29.9% 30.5% V5 (many diffs) n/a
3 TRCN0000470394 TTGAGGGTCCCGTGCTGCTTATGC pLX_317 55.5% 29.9% 30.5% V5 (many diffs) n/a
Download CSV