Transcript: Mouse XM_006510472.2

PREDICTED: Mus musculus coiled-coil domain containing 84 (Ccdc84), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc84 (382073)
Length:
1256
CDS:
92..1111

Additional Resources:

NCBI RefSeq record:
XM_006510472.2
NBCI Gene record:
Ccdc84 (382073)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510472.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181697 CCAGGATTATGCACGGTTTAA pLKO.1 460 CDS 100% 13.200 18.480 N Ccdc84 n/a
2 TRCN0000246383 CACCCGGAATTGGTAACATTC pLKO_005 801 CDS 100% 10.800 15.120 N Ccdc84 n/a
3 TRCN0000182862 CCCAGGATTATGCACGGTTTA pLKO.1 459 CDS 100% 10.800 15.120 N Ccdc84 n/a
4 TRCN0000246384 AGGAGGACGAGGTGATTAAAG pLKO_005 519 CDS 100% 13.200 9.240 N Ccdc84 n/a
5 TRCN0000246385 CAGGATTATGCACGGTTTAAG pLKO_005 461 CDS 100% 13.200 9.240 N Ccdc84 n/a
6 TRCN0000246382 CTGGCAGTCCAGGCATCAATT pLKO_005 1039 CDS 100% 13.200 9.240 N Ccdc84 n/a
7 TRCN0000246386 ACAGGACAGCAACTAACATTC pLKO_005 764 CDS 100% 10.800 7.560 N Ccdc84 n/a
8 TRCN0000181786 GCCCAGATGAAAGAGAAGTTT pLKO.1 428 CDS 100% 5.625 3.938 N Ccdc84 n/a
9 TRCN0000182073 CAAATTCTGGTGGGAGAACAA pLKO.1 400 CDS 100% 4.950 3.465 N Ccdc84 n/a
10 TRCN0000198563 GCTTGGATTCCTATGAGGAAA pLKO.1 498 CDS 100% 4.950 3.465 N Ccdc84 n/a
11 TRCN0000142088 CAACAAATTCTGGTGGGAGAA pLKO.1 397 CDS 100% 4.050 2.835 N CCDC84 n/a
12 TRCN0000140926 CCAACAAATTCTGGTGGGAGA pLKO.1 396 CDS 100% 2.160 1.512 N CCDC84 n/a
13 TRCN0000181525 GAGGTGATTAAAGAGATGGCA pLKO.1 527 CDS 100% 0.750 0.525 N Ccdc84 n/a
14 TRCN0000421061 AGATGAAAGAGAAGTTTCTGG pLKO_005 432 CDS 100% 2.640 1.848 N CCDC84 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510472.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05441 pDONR223 100% 83.7% 84.3% None (many diffs) n/a
2 ccsbBroad304_05441 pLX_304 0% 83.7% 84.3% V5 (many diffs) n/a
3 TRCN0000467756 TACCTGTACCTGCCAGTTCTCTTC pLX_317 15.7% 83.7% 84.3% V5 (many diffs) n/a
Download CSV