Transcript: Mouse XM_006510856.2

PREDICTED: Mus musculus pyruvate kinase, muscle (Pkm), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pkm (18746)
Length:
2104
CDS:
16..1566

Additional Resources:

NCBI RefSeq record:
XM_006510856.2
NBCI Gene record:
Pkm (18746)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510856.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374370 CCCGCAACACTGGCATCATTT pLKO_005 187 CDS 100% 13.200 18.480 N Pkm n/a
2 TRCN0000199494 GCCCGAGGCTTCTTCAAGAAG pLKO.1 1465 CDS 100% 1.650 2.310 N PKM n/a
3 TRCN0000366062 GACTGGAAACCCTGACTTTAT pLKO_005 1776 3UTR 100% 13.200 9.240 N Pkm n/a
4 TRCN0000366063 ATCATTGCCGTGACTCGAAAT pLKO_005 1318 CDS 100% 10.800 7.560 N Pkm n/a
5 TRCN0000374306 GACATGGTGTTTGCATCTTTC pLKO_005 682 CDS 100% 10.800 7.560 N Pkm n/a
6 TRCN0000365989 GATGTCGACCTTCGTGTAAAC pLKO_005 1423 CDS 100% 10.800 7.560 N Pkm n/a
7 TRCN0000025622 ACTGGCATCATTTGTACCATT pLKO.1 195 CDS 100% 4.950 3.465 N Gm6560 n/a
8 TRCN0000024723 CCATGCAGAGACCATCAAGAA pLKO.1 219 CDS 100% 4.950 3.465 N Pkm n/a
9 TRCN0000025621 CCGCAGGTTTGATGAGATCTT pLKO.1 801 CDS 100% 4.950 3.465 N Gm6560 n/a
10 TRCN0000025620 GCAGAGACCATCAAGAATGTT pLKO.1 223 CDS 100% 5.625 3.938 N Gm6560 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510856.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01211 pDONR223 100% 82.9% 84.6% None (many diffs) n/a
2 ccsbBroad304_01211 pLX_304 0% 82.9% 84.6% V5 (many diffs) n/a
3 ccsbBroadEn_14768 pDONR223 0% 82.9% 84.6% None (many diffs) n/a
4 ccsbBroad304_14768 pLX_304 0% 82.9% 84.6% V5 (many diffs) n/a
5 TRCN0000489008 AGCCACGCGCCTATAATTAAACAA pLX_317 21.5% 82.9% 84.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV