Transcript: Mouse XM_006510890.3

PREDICTED: Mus musculus transcriptional regulator, SIN3A (yeast) (Sin3a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sin3a (20466)
Length:
5213
CDS:
390..4223

Additional Resources:

NCBI RefSeq record:
XM_006510890.3
NBCI Gene record:
Sin3a (20466)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510890.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336547 AGACTACGTGGAGCGATATAT pLKO_005 3698 CDS 100% 15.000 21.000 N Sin3a n/a
2 TRCN0000353513 GCCGAGTGTCCCAGCTATTTA pLKO_005 886 CDS 100% 15.000 21.000 N Sin3a n/a
3 TRCN0000336476 GCTAAGATCTCTGTTAGATTT pLKO_005 4675 3UTR 100% 13.200 18.480 N Sin3a n/a
4 TRCN0000039373 GCTGTTCCGATTGTCCTTAAA pLKO.1 2463 CDS 100% 13.200 18.480 N Sin3a n/a
5 TRCN0000039371 CCCTAAGTCCAAGTTGCTATT pLKO.1 2975 CDS 100% 10.800 15.120 N Sin3a n/a
6 TRCN0000021778 CGTGTCAAATACGGCACAGTA pLKO.1 4188 CDS 100% 4.950 6.930 N SIN3A n/a
7 TRCN0000336544 ACCCAAACTGATGAGTCTAAA pLKO_005 1715 CDS 100% 13.200 9.240 N Sin3a n/a
8 TRCN0000336545 ACGGGAGGTGCTAGGCATAAA pLKO_005 3173 CDS 100% 13.200 9.240 N Sin3a n/a
9 TRCN0000039370 GCCTCAGGTCTACAATGATTT pLKO.1 809 CDS 100% 13.200 9.240 N Sin3a n/a
10 TRCN0000218101 TGCTTTGATGTGCTAGCATAA pLKO_005 4981 3UTR 100% 10.800 7.560 N SIN3A n/a
11 TRCN0000039372 CCCTGAATTGTTTAATTGGTT pLKO.1 1925 CDS 100% 3.000 2.100 N Sin3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510890.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11788 pDONR223 100% 10.7% 9.7% None (many diffs) n/a
2 ccsbBroad304_11788 pLX_304 0% 10.7% 9.7% V5 (many diffs) n/a
3 TRCN0000480239 GTACGATTCAGAACATCATTATTA pLX_317 75% 10.7% 9.7% V5 (many diffs) n/a
Download CSV