Transcript: Mouse XM_006510947.3

PREDICTED: Mus musculus 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1 (Hmgcll1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hmgcll1 (208982)
Length:
3799
CDS:
409..1314

Additional Resources:

NCBI RefSeq record:
XM_006510947.3
NBCI Gene record:
Hmgcll1 (208982)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510947.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120092 CCCTAGTCTATTTCCATAATA pLKO.1 2086 3UTR 100% 15.000 12.000 N Hmgcll1 n/a
2 TRCN0000062414 CCATTGAAGAAAGTATGGGAA pLKO.1 878 CDS 100% 2.640 2.112 N HMGCLL1 n/a
3 TRCN0000120093 CCTGTCCTTACACCTAATCTT pLKO.1 763 CDS 100% 5.625 3.938 N Hmgcll1 n/a
4 TRCN0000120096 CCAAGGGATGGATTGCAGAAT pLKO.1 571 CDS 100% 4.950 3.465 N Hmgcll1 n/a
5 TRCN0000120094 GCAAATATCCTAACAGCTCTT pLKO.1 1180 CDS 100% 4.050 2.835 N Hmgcll1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510947.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03427 pDONR223 100% 75.9% 79.8% None (many diffs) n/a
2 ccsbBroad304_03427 pLX_304 0% 75.9% 79.8% V5 (many diffs) n/a
3 TRCN0000474885 TCCCGTCAATATCTAATATACCAC pLX_317 49.9% 75.9% 79.8% V5 (many diffs) n/a
Download CSV