Transcript: Mouse XM_006511085.3

PREDICTED: Mus musculus Dmx-like 2 (Dmxl2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dmxl2 (235380)
Length:
10621
CDS:
263..9361

Additional Resources:

NCBI RefSeq record:
XM_006511085.3
NBCI Gene record:
Dmxl2 (235380)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511085.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253306 CATGCTAAGCAGTCCATATTT pLKO_005 9200 CDS 100% 15.000 21.000 N Dmxl2 n/a
2 TRCN0000253308 CTTGCAGCCCACCCGTTAAAT pLKO_005 7358 CDS 100% 15.000 21.000 N Dmxl2 n/a
3 TRCN0000253310 GTGTGCCTTGCACCTTATTTA pLKO_005 3287 CDS 100% 15.000 12.000 N Dmxl2 n/a
4 TRCN0000253307 ATAAACTATGCAGCGTTAAAT pLKO_005 10240 3UTR 100% 15.000 10.500 N Dmxl2 n/a
5 TRCN0000253309 CATGGTTATTGCCCGTTTATT pLKO_005 5512 CDS 100% 15.000 9.000 N Dmxl2 n/a
6 TRCN0000142512 GCCACAAGTGACTTTGCATTT pLKO.1 8810 CDS 100% 10.800 6.480 N DMXL2 n/a
7 TRCN0000338742 GCCACAAGTGACTTTGCATTT pLKO_005 8810 CDS 100% 10.800 6.480 N DMXL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511085.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.