Transcript: Mouse XM_006511343.2

PREDICTED: Mus musculus COMM domain containing 4 (Commd4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Commd4 (66199)
Length:
814
CDS:
76..609

Additional Resources:

NCBI RefSeq record:
XM_006511343.2
NBCI Gene record:
Commd4 (66199)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511343.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375726 GTGCCGCTGTTACGAAGAGAA pLKO_005 327 CDS 100% 4.950 6.930 N Commd4 n/a
2 TRCN0000375728 CATCTGCAGCTACAGGTTGTG pLKO_005 475 CDS 100% 4.050 5.670 N Commd4 n/a
3 TRCN0000184616 GTTTGAGTCTGGAGACGTGAA pLKO.1 186 CDS 100% 4.050 5.670 N Commd4 n/a
4 TRCN0000340173 GTTTGAGTCTGGAGACGTGAA pLKO_005 186 CDS 100% 4.050 5.670 N Commd4 n/a
5 TRCN0000375727 CAGACCATGATGACTGCTTTG pLKO_005 583 CDS 100% 6.000 4.200 N Commd4 n/a
6 TRCN0000184674 CTGCTGATGCCAAGTTTGAGT pLKO.1 173 CDS 100% 3.000 2.100 N Commd4 n/a
7 TRCN0000184568 GAAGCTTACTGCTGATGCCAA pLKO.1 165 CDS 100% 2.640 1.848 N Commd4 n/a
8 TRCN0000196014 GACAGTGATTCCTTGTCCAGT pLKO.1 262 CDS 100% 2.640 1.848 N Commd4 n/a
9 TRCN0000340174 GACAGTGATTCCTTGTCCAGT pLKO_005 262 CDS 100% 2.640 1.848 N Commd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511343.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03489 pDONR223 100% 77.2% 79.8% None (many diffs) n/a
2 ccsbBroad304_03489 pLX_304 0% 77.2% 79.8% V5 (many diffs) n/a
3 TRCN0000479852 TGGTAACCCCCCAGACACTCCAAT pLX_317 62% 77.2% 79.8% V5 (many diffs) n/a
Download CSV