Transcript: Mouse XM_006511706.3

PREDICTED: Mus musculus topoisomerase (DNA) II binding protein 1 (Topbp1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Topbp1 (235559)
Length:
5124
CDS:
212..4612

Additional Resources:

NCBI RefSeq record:
XM_006511706.3
NBCI Gene record:
Topbp1 (235559)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511706.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124222 CGCTTTATATCTGTGACCGTT pLKO.1 378 CDS 100% 2.640 2.112 N Topbp1 n/a
2 TRCN0000124223 GCCAGAAGAGTTTCCTTGTTT pLKO.1 1881 CDS 100% 5.625 3.938 N Topbp1 n/a
3 TRCN0000331542 GCCAGAAGAGTTTCCTTGTTT pLKO_005 1881 CDS 100% 5.625 3.938 N Topbp1 n/a
4 TRCN0000124220 GCTCTTAGAAACTGCGAGAAT pLKO.1 2380 CDS 100% 4.950 3.465 N Topbp1 n/a
5 TRCN0000302497 GCTCTTAGAAACTGCGAGAAT pLKO_005 2380 CDS 100% 4.950 3.465 N Topbp1 n/a
6 TRCN0000124221 GCTTTATATCTGTGACCGTTT pLKO.1 379 CDS 100% 4.050 2.835 N Topbp1 n/a
7 TRCN0000302500 GCTTTATATCTGTGACCGTTT pLKO_005 379 CDS 100% 4.050 2.835 N Topbp1 n/a
8 TRCN0000124219 CCTGAATTTGAATCACTGGTT pLKO.1 4805 3UTR 100% 2.640 1.848 N Topbp1 n/a
9 TRCN0000302499 CCTGAATTTGAATCACTGGTT pLKO_005 4805 3UTR 100% 2.640 1.848 N Topbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511706.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.