Transcript: Mouse XM_006511725.2

PREDICTED: Mus musculus ariadne RBR E3 ubiquitin protein ligase 2 (Arih2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arih2 (23807)
Length:
4068
CDS:
450..1928

Additional Resources:

NCBI RefSeq record:
XM_006511725.2
NBCI Gene record:
Arih2 (23807)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511725.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041027 GCACAAACATATGAGCGGATT pLKO.1 1593 CDS 100% 0.000 0.000 N Arih2 n/a
2 TRCN0000316888 GCACAAACATATGAGCGGATT pLKO_005 1593 CDS 100% 0.000 0.000 N Arih2 n/a
3 TRCN0000041023 GAGGACTACTATGTGGGAGTA pLKO.1 552 CDS 100% 4.050 3.240 N Arih2 n/a
4 TRCN0000041024 CCCAGGAAGAAGCTGTTTGAA pLKO.1 1758 CDS 100% 5.625 3.938 N Arih2 n/a
5 TRCN0000316889 CCCAGGAAGAAGCTGTTTGAA pLKO_005 1758 CDS 100% 5.625 3.938 N Arih2 n/a
6 TRCN0000041026 CCAATGAAGAATTGAGAGATA pLKO.1 1051 CDS 100% 4.950 3.465 N Arih2 n/a
7 TRCN0000316887 CCAATGAAGAATTGAGAGATA pLKO_005 1051 CDS 100% 4.950 3.465 N Arih2 n/a
8 TRCN0000041025 CGCTACCTCTTTAGGGACTAT pLKO.1 1080 CDS 100% 4.950 3.465 N Arih2 n/a
9 TRCN0000316890 CGCTACCTCTTTAGGGACTAT pLKO_005 1080 CDS 100% 4.950 3.465 N Arih2 n/a
10 TRCN0000034272 GCTGGATGTGTCTAGGAGATT pLKO.1 1414 CDS 100% 4.950 2.970 N ARIH2 n/a
11 TRCN0000298272 GCTGGATGTGTCTAGGAGATT pLKO_005 1414 CDS 100% 4.950 2.970 N ARIH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511725.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02426 pDONR223 100% 91.4% 98.1% None (many diffs) n/a
2 ccsbBroad304_02426 pLX_304 0% 91.4% 98.1% V5 (many diffs) n/a
3 TRCN0000479033 TCAACTACTTGACCCAAAAACTCC pLX_317 25.9% 91.4% 98.1% V5 (many diffs) n/a
Download CSV