Transcript: Mouse XM_006511918.3

PREDICTED: Mus musculus integrin alpha 9 (Itga9), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Itga9 (104099)
Length:
6381
CDS:
227..2710

Additional Resources:

NCBI RefSeq record:
XM_006511918.3
NBCI Gene record:
Itga9 (104099)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511918.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436962 GGGTAACTGCTCTCTACAAAG pLKO_005 2158 CDS 100% 10.800 15.120 N Itga9 n/a
2 TRCN0000066329 GCGATTATGAACAGACGGTAT pLKO.1 314 CDS 100% 4.050 5.670 N Itga9 n/a
3 TRCN0000066328 GCTGTTACCTTGTGGTATAAT pLKO.1 3638 3UTR 100% 15.000 12.000 N Itga9 n/a
4 TRCN0000066331 CCGCACCATCAACCTATACAT pLKO.1 2341 CDS 100% 5.625 3.938 N Itga9 n/a
5 TRCN0000066330 CCCAGAAGAATCAGACAGTTT pLKO.1 1428 CDS 100% 4.950 3.465 N Itga9 n/a
6 TRCN0000066332 GCAAGAATGTACCAGGAGAAA pLKO.1 1107 CDS 100% 4.950 3.465 N Itga9 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6182 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511918.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10926 pDONR223 100% 34.1% 34.7% None (many diffs) n/a
2 ccsbBroad304_10926 pLX_304 0% 34.1% 34.7% V5 (many diffs) n/a
3 TRCN0000475453 AGAGTCCTTCGAAGATTGCCAAGC pLX_317 19.6% 34.1% 34.7% V5 (many diffs) n/a
Download CSV