Transcript: Mouse XM_006511946.3

PREDICTED: Mus musculus mutL homolog 1 (Mlh1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mlh1 (17350)
Length:
1870
CDS:
88..1650

Additional Resources:

NCBI RefSeq record:
XM_006511946.3
NBCI Gene record:
Mlh1 (17350)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511946.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042722 GCACATTATCTATAAAGCCTT pLKO.1 1530 CDS 100% 2.640 3.696 N Mlh1 n/a
2 TRCN0000042720 CCGAAGCATTTCACAGAAGAT pLKO.1 1570 CDS 100% 4.950 3.465 N Mlh1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511946.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01019 pDONR223 100% 58.2% 53.9% None (many diffs) n/a
2 ccsbBroad304_01019 pLX_304 0% 58.2% 53.9% V5 (many diffs) n/a
3 TRCN0000489469 ACCTGGAAGACTAAACTACCCCCC pLX_317 15.6% 58.2% 53.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV