Transcript: Mouse XM_006512016.3

PREDICTED: Mus musculus src homology three (SH3) and cysteine rich domain (Stac), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stac (20840)
Length:
2853
CDS:
483..1661

Additional Resources:

NCBI RefSeq record:
XM_006512016.3
NBCI Gene record:
Stac (20840)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512016.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416094 CACGGAGCAACAGTGTGTTTA pLKO_005 1204 CDS 100% 13.200 18.480 N Stac n/a
2 TRCN0000105761 GCCAACTTTGTTCAGAGAGTA pLKO.1 1458 CDS 100% 4.950 6.930 N Stac n/a
3 TRCN0000134576 GCATTAAAGAAGTTATGCCCA pLKO.1 1000 CDS 100% 0.660 0.924 N STAC n/a
4 TRCN0000413870 AGAGCATGAGAAGATTTATAG pLKO_005 1481 CDS 100% 13.200 9.240 N Stac n/a
5 TRCN0000105764 ACGAACAGTTTGGATGCATTA pLKO.1 985 CDS 100% 10.800 7.560 N Stac n/a
6 TRCN0000426778 GATGACTTCAGAGATCAAATG pLKO_005 1245 CDS 100% 10.800 7.560 N Stac n/a
7 TRCN0000105760 GCTCAGTTTGTGTCTCAGTTT pLKO.1 2112 3UTR 100% 4.950 3.465 N Stac n/a
8 TRCN0000138733 CCAGCCAACTTTGTTCAGAGA pLKO.1 1455 CDS 100% 2.640 1.848 N STAC n/a
9 TRCN0000105762 CCCATTACAGATGAACACCTA pLKO.1 1301 CDS 100% 2.640 1.584 N Stac n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512016.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07007 pDONR223 100% 82.2% 79.9% None (many diffs) n/a
2 ccsbBroad304_07007 pLX_304 0% 82.2% 79.9% V5 (many diffs) n/a
3 TRCN0000492333 ACCAGCCGCGCTTCTGCTGAAATT pLX_317 34.9% 82.2% 79.9% V5 (many diffs) n/a
Download CSV