Transcript: Mouse XM_006512145.3

PREDICTED: Mus musculus zinc finger protein 651 (Zfp651), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp651 (270210)
Length:
4802
CDS:
212..2317

Additional Resources:

NCBI RefSeq record:
XM_006512145.3
NBCI Gene record:
Zfp651 (270210)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512145.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218586 ATTGTTGAGGTGAACCTTAAC pLKO_005 908 CDS 100% 10.800 7.560 N Zfp651 n/a
2 TRCN0000225632 CAGGCCTCCCAAAGATCTATG pLKO_005 654 CDS 100% 10.800 7.560 N Zfp651 n/a
3 TRCN0000225633 TTCATGAGCACAACAAGATAG pLKO_005 1674 CDS 100% 10.800 7.560 N Zfp651 n/a
4 TRCN0000428941 GCAGATCCTCAACTTCATCTA pLKO_005 415 CDS 100% 4.950 3.465 N ZBTB47 n/a
5 TRCN0000107923 GTCACACATGAGCATCCACAT pLKO.1 1936 CDS 100% 4.050 2.835 N ZBTB47 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512145.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12986 pDONR223 100% 40.1% 41.9% None (many diffs) n/a
2 ccsbBroad304_12986 pLX_304 0% 40.1% 41.9% V5 (many diffs) n/a
3 TRCN0000479175 TCCCGATCGGGCTCTAACACCTGA pLX_317 40.1% 40.1% 41.9% V5 (many diffs) n/a
Download CSV