Transcript: Mouse XM_006512385.3

PREDICTED: Mus musculus CLIP associating protein 2 (Clasp2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clasp2 (76499)
Length:
6897
CDS:
623..5281

Additional Resources:

NCBI RefSeq record:
XM_006512385.3
NBCI Gene record:
Clasp2 (76499)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512385.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184683 CGTGTTCAGAACGCTCCTATA pLKO.1 3294 CDS 100% 10.800 8.640 N Clasp2 n/a
2 TRCN0000184224 GCCGCACAGTATGATTGCTTT pLKO.1 1691 CDS 100% 4.950 3.960 N Clasp2 n/a
3 TRCN0000346542 GCCGCACAGTATGATTGCTTT pLKO_005 1691 CDS 100% 4.950 3.960 N Clasp2 n/a
4 TRCN0000183632 GAACTTGAAGAGACGTTAAAT pLKO.1 1580 CDS 100% 15.000 10.500 N Clasp2 n/a
5 TRCN0000346622 GAACTTGAAGAGACGTTAAAT pLKO_005 1580 CDS 100% 15.000 10.500 N Clasp2 n/a
6 TRCN0000184355 GCATCACTGTTGCTCACCTTT pLKO.1 1791 CDS 100% 4.950 3.465 N Clasp2 n/a
7 TRCN0000346624 GCATCACTGTTGCTCACCTTT pLKO_005 1791 CDS 100% 4.950 3.465 N Clasp2 n/a
8 TRCN0000183187 GCTACTAAACTTCTTCACAAT pLKO.1 4007 CDS 100% 4.950 3.465 N Clasp2 n/a
9 TRCN0000346625 GCTACTAAACTTCTTCACAAT pLKO_005 4007 CDS 100% 4.950 3.465 N Clasp2 n/a
10 TRCN0000108255 GCCAGTGTTATGATTGTATAA pLKO.1 5577 3UTR 100% 13.200 9.240 N CLASP2 n/a
11 TRCN0000300965 GCCAGTGTTATGATTGTATAA pLKO_005 5577 3UTR 100% 13.200 9.240 N CLASP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512385.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11679 pDONR223 100% 24.8% 25.8% None (many diffs) n/a
2 ccsbBroad304_11679 pLX_304 0% 24.8% 25.8% V5 (many diffs) n/a
3 TRCN0000467912 TTATGCAAACGTTACGCAGACATC pLX_317 34% 24.8% 25.8% V5 (many diffs) n/a
Download CSV