Transcript: Mouse XM_006512550.3

PREDICTED: Mus musculus glutamate receptor, metabotropic 1 (Grm1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grm1 (14816)
Length:
5844
CDS:
61..2940

Additional Resources:

NCBI RefSeq record:
XM_006512550.3
NBCI Gene record:
Grm1 (14816)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512550.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240439 GGCGCCAGCTGAATCATAAAT pLKO_005 3423 3UTR 100% 15.000 21.000 N LOC100045018 n/a
2 TRCN0000220804 GCCTCCATTCTGATTAGTGTA pLKO.1 1468 CDS 100% 4.950 6.930 N Grm1 n/a
3 TRCN0000025746 CCTGTAACCAAACAGCCGTAA pLKO.1 2108 CDS 100% 4.050 5.670 N Grm1 n/a
4 TRCN0000220803 CCGAGCATCAAGGAAGTCTAT pLKO.1 1549 CDS 100% 4.950 3.465 N Grm1 n/a
5 TRCN0000220806 GCCTGCAAAGAGAATGAGTTT pLKO.1 985 CDS 100% 4.950 3.465 N Grm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512550.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488800 CTAACTCGTCTTCGGTTCTGTGCC pLX_317 7.7% 69.7% 74.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489197 GGTACACCCGTGTGGTACCCGATA pLX_317 9.3% 69.6% 74.7% V5 (many diffs) n/a
Download CSV