Transcript: Mouse XM_006512735.3

PREDICTED: Mus musculus l(3)mbt-like 3 (Drosophila) (L3mbtl3), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
L3mbtl3 (237339)
Length:
4326
CDS:
98..2674

Additional Resources:

NCBI RefSeq record:
XM_006512735.3
NBCI Gene record:
L3mbtl3 (237339)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512735.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431896 CAATCGTTTCCTGGTACATTT pLKO_005 1216 CDS 100% 13.200 18.480 N L3MBTL3 n/a
2 TRCN0000097627 CCAGCTAGTAGAGTTTCCAAA pLKO.1 2432 CDS 100% 4.950 6.930 N L3mbtl3 n/a
3 TRCN0000097625 CCCAGCTAGTAGAGTTTCCAA pLKO.1 2431 CDS 100% 3.000 4.200 N L3mbtl3 n/a
4 TRCN0000097628 GCACCAATCCTTCCCATATAA pLKO.1 781 CDS 100% 15.000 10.500 N L3mbtl3 n/a
5 TRCN0000435513 GGATGAGAGCTATGACTATTG pLKO_005 1246 CDS 100% 10.800 7.560 N L3MBTL3 n/a
6 TRCN0000097624 CCGCTCACTGAGCTAAACTTA pLKO.1 2887 3UTR 100% 5.625 3.938 N L3mbtl3 n/a
7 TRCN0000097626 CCAGGCTATTCTCATGTGAAA pLKO.1 1340 CDS 100% 4.950 3.465 N L3mbtl3 n/a
8 TRCN0000150657 GTAACAGATATGGTGGACAAT pLKO.1 1199 CDS 100% 4.950 3.465 N L3MBTL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512735.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09192 pDONR223 100% 75.2% 78.4% None (many diffs) n/a
2 ccsbBroad304_09192 pLX_304 0% 75.2% 78.4% V5 (many diffs) n/a
3 TRCN0000469035 ACTACTTCGTCCCCATCTCTGACC pLX_317 20.5% 75.2% 78.4% V5 (many diffs) n/a
Download CSV