Transcript: Mouse XM_006512769.3

PREDICTED: Mus musculus BEN domain containing 3 (Bend3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bend3 (331623)
Length:
6155
CDS:
354..2831

Additional Resources:

NCBI RefSeq record:
XM_006512769.3
NBCI Gene record:
Bend3 (331623)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512769.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198216 CCTAGCAAGTTACGCAATCAA pLKO.1 2351 CDS 100% 5.625 7.875 N Bend3 n/a
2 TRCN0000451175 AGACGACATCTCGGTGGTCAA pLKO_005 1859 CDS 100% 4.050 5.670 N Bend3 n/a
3 TRCN0000197685 CGTGATAACTTTAATGGCTTA pLKO.1 4311 3UTR 100% 4.050 3.240 N Bend3 n/a
4 TRCN0000197391 CAATGGACTCACGACTAATAT pLKO.1 953 CDS 100% 15.000 10.500 N Bend3 n/a
5 TRCN0000449832 ACCTGCGCAAGCAGTACAACT pLKO_005 2113 CDS 100% 4.950 3.465 N Bend3 n/a
6 TRCN0000452970 GAGTCTCAGAAGCGGGAATGT pLKO_005 864 CDS 100% 4.950 3.465 N Bend3 n/a
7 TRCN0000177224 GATCCAGAAGATGTTCTACAT pLKO.1 929 CDS 100% 4.950 3.465 N Bend3 n/a
8 TRCN0000441242 TGACTTCTTCAGCCGCTTCTG pLKO_005 1343 CDS 100% 4.050 2.835 N Bend3 n/a
9 TRCN0000176798 CTATGAATGTATACCTAGCAT pLKO.1 2738 CDS 100% 3.000 2.100 N Bend3 n/a
10 TRCN0000443156 CAACTACACAGAGATCTACTT pLKO_005 1700 CDS 100% 4.950 2.970 N Bend3 n/a
11 TRCN0000247562 TGCAGCTCATCCGCAACTATG pLKO_005 1255 CDS 100% 10.800 7.560 N BEND3 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4701 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512769.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08755 pDONR223 100% 86.1% 90.7% None (many diffs) n/a
2 ccsbBroad304_08755 pLX_304 0% 86.1% 90.7% V5 (many diffs) n/a
3 TRCN0000468756 TCAAGCCAGCCGACGTACGTGCCT pLX_317 5.9% 86.1% 90.7% V5 (many diffs) n/a
Download CSV