Transcript: Mouse XM_006512800.2

PREDICTED: Mus musculus syntaxin 7 (Stx7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stx7 (53331)
Length:
2212
CDS:
186..971

Additional Resources:

NCBI RefSeq record:
XM_006512800.2
NBCI Gene record:
Stx7 (53331)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512800.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100562 GCCAATGTAGAAAGTGCGGAA pLKO.1 807 CDS 100% 2.160 3.024 N Stx7 n/a
2 TRCN0000324557 GCCAATGTAGAAAGTGCGGAA pLKO_005 807 CDS 100% 2.160 3.024 N Stx7 n/a
3 TRCN0000100564 CGATATGATTGACAGCATAGA pLKO.1 785 CDS 100% 4.950 3.960 N Stx7 n/a
4 TRCN0000324558 CGATATGATTGACAGCATAGA pLKO_005 785 CDS 100% 4.950 3.960 N Stx7 n/a
5 TRCN0000100561 GCGTCAGAGAAAGATACAGAA pLKO.1 434 CDS 100% 4.950 3.960 N Stx7 n/a
6 TRCN0000324477 GCGTCAGAGAAAGATACAGAA pLKO_005 434 CDS 100% 4.950 3.960 N Stx7 n/a
7 TRCN0000100560 CCAGTCTCTTACTGCACTGAA pLKO.1 1732 3UTR 100% 4.950 3.465 N Stx7 n/a
8 TRCN0000324555 CCAGTCTCTTACTGCACTGAA pLKO_005 1732 3UTR 100% 4.950 3.465 N Stx7 n/a
9 TRCN0000100563 GAAGCTGATATTATGGACATT pLKO.1 720 CDS 100% 4.950 3.465 N Stx7 n/a
10 TRCN0000324478 GAAGCTGATATTATGGACATT pLKO_005 720 CDS 100% 4.950 3.465 N Stx7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512800.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01925 pDONR223 100% 87% 94.2% None (many diffs) n/a
2 ccsbBroad304_01925 pLX_304 0% 87% 94.2% V5 (many diffs) n/a
3 TRCN0000474079 CACCGTCAAGCTCCTCGGATAATC pLX_317 71.3% 87% 94.2% V5 (many diffs) n/a
Download CSV