Transcript: Mouse XM_006512806.1

PREDICTED: Mus musculus forkhead box O3 (Foxo3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Foxo3 (56484)
Length:
6838
CDS:
334..2352

Additional Resources:

NCBI RefSeq record:
XM_006512806.1
NBCI Gene record:
Foxo3 (56484)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512806.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374252 AGTGGACAGTGATCCGTTTAC pLKO_005 2446 3UTR 100% 10.800 15.120 N Foxo3 n/a
2 TRCN0000071616 CGGCACCATGAATCTGAATGA pLKO.1 1449 CDS 100% 4.950 6.930 N Foxo3 n/a
3 TRCN0000071613 GAGTCCATCATCCGTAGTGAA pLKO.1 2203 CDS 100% 4.950 6.930 N Foxo3 n/a
4 TRCN0000071614 CCCGGACAAACGGCTCACTTT pLKO.1 849 CDS 100% 1.650 2.310 N Foxo3 n/a
5 TRCN0000071615 GCTTCGCAACGATCCAATGAT pLKO.1 1860 CDS 100% 5.625 4.500 N Foxo3 n/a
6 TRCN0000312843 CAGCCGTGCCTTGTCAAATTC pLKO_005 1968 CDS 100% 13.200 9.240 N Foxo3 n/a
7 TRCN0000312802 CCGTGGAACAGAACTCTATAA pLKO_005 2551 3UTR 100% 13.200 9.240 N Foxo3 n/a
8 TRCN0000312844 CCGGCACCATGAATCTGAATG pLKO_005 1448 CDS 100% 10.800 7.560 N Foxo3 n/a
9 TRCN0000071617 GTTTGGACCTTCGTCTCTGAA pLKO.1 1632 CDS 100% 4.950 3.465 N Foxo3 n/a
10 TRCN0000311862 GTTTGGACCTTCGTCTCTGAA pLKO_005 1632 CDS 100% 4.950 3.465 N Foxo3 n/a
11 TRCN0000010335 CATGTTCAATGGGAGCTTGGA pLKO.1 2172 CDS 100% 2.640 1.848 N FOXO3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512806.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00577 pDONR223 100% 90.3% 94.6% None (many diffs) n/a
2 ccsbBroad304_00577 pLX_304 0% 90.3% 94.6% V5 (many diffs) n/a
3 TRCN0000470127 TTAATAAGCTTCTTTGCTCCAATA pLX_317 18.3% 90.3% 94.6% V5 (many diffs) n/a
Download CSV