Transcript: Mouse XM_006512926.3

PREDICTED: Mus musculus syntaxin binding protein 5 (tomosyn) (Stxbp5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stxbp5 (78808)
Length:
7162
CDS:
540..3998

Additional Resources:

NCBI RefSeq record:
XM_006512926.3
NBCI Gene record:
Stxbp5 (78808)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512926.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267421 ATCGAACTTTACGGCTCAAAT pLKO_005 2547 CDS 100% 13.200 18.480 N Stxbp5 n/a
2 TRCN0000252595 ATCTGACGGGCTTCGTGATAA pLKO_005 2309 CDS 100% 13.200 18.480 N Stxbp5 n/a
3 TRCN0000252598 CGGTACTATATTGAGGTTAAA pLKO_005 3086 CDS 100% 13.200 18.480 N Stxbp5 n/a
4 TRCN0000252596 TTCGCATGTGACATTAGTAAA pLKO_005 7002 3UTR 100% 13.200 18.480 N Stxbp5 n/a
5 TRCN0000148758 CCTCCTCTTCTCAGGAAATTA pLKO.1 3250 CDS 100% 15.000 10.500 N STXBP5 n/a
6 TRCN0000252597 ATGCTGATGGCTCGGTGAAAT pLKO_005 1906 CDS 100% 13.200 9.240 N Stxbp5 n/a
7 TRCN0000431626 TGCAATAACTCTACAAGTATT pLKO_005 1940 CDS 100% 13.200 9.240 N STXBP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512926.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16093 pDONR223 0% 86.1% 93.9% None (many diffs) n/a
2 ccsbBroad304_16093 pLX_304 0% 86.1% 93.9% V5 (many diffs) n/a
3 ccsbBroadEn_09557 pDONR223 100% 86.1% 94% None (many diffs) n/a
4 ccsbBroad304_09557 pLX_304 0% 86.1% 94% V5 (many diffs) n/a
Download CSV