Transcript: Mouse XM_006513140.2

PREDICTED: Mus musculus SLIT-ROBO Rho GTPase activating protein 1 (Srgap1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Srgap1 (117600)
Length:
8464
CDS:
863..4057

Additional Resources:

NCBI RefSeq record:
XM_006513140.2
NBCI Gene record:
Srgap1 (117600)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513140.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251713 CCGAAATTGAGACGGAATATT pLKO_005 969 CDS 100% 15.000 21.000 N Srgap1 n/a
2 TRCN0000251715 CGCCATTCTGATAGCTATTTA pLKO_005 3314 CDS 100% 15.000 21.000 N Srgap1 n/a
3 TRCN0000265238 AGGACTCCACCCGGATGTTTA pLKO_005 1200 CDS 100% 13.200 9.240 N Srgap1 n/a
4 TRCN0000251714 CCAGTGAACTGCTGGTATTTG pLKO_005 1085 CDS 100% 13.200 9.240 N Srgap1 n/a
5 TRCN0000251716 TTGCCCAGGTCGGTCCTTATA pLKO_005 2666 CDS 100% 13.200 9.240 N Srgap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513140.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12358 pDONR223 100% 38.7% 40.1% None (many diffs) n/a
2 ccsbBroad304_12358 pLX_304 0% 38.7% 40.1% V5 (many diffs) n/a
3 TRCN0000481319 ACTAATCCGTAGCTAAGATCATCA pLX_317 34.2% 38.7% 40.1% V5 (many diffs) n/a
Download CSV