Transcript: Mouse XM_006513195.2

PREDICTED: Mus musculus death-associated protein kinase 3 (Dapk3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dapk3 (13144)
Length:
1545
CDS:
139..1485

Additional Resources:

NCBI RefSeq record:
XM_006513195.2
NBCI Gene record:
Dapk3 (13144)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024245 CGCATTAAGCTCATCGACTTT pLKO.1 604 CDS 100% 4.950 6.930 N Dapk3 n/a
2 TRCN0000024248 GCATGACGTGTTCGAGAACAA pLKO.1 375 CDS 100% 4.950 6.930 N Dapk3 n/a
3 TRCN0000024247 CCACGCAGTTCCTCAAACAAA pLKO.1 485 CDS 100% 5.625 3.938 N Dapk3 n/a
4 TRCN0000024246 GCAGTGAACTATGACTTTGAT pLKO.1 829 CDS 100% 5.625 3.938 N Dapk3 n/a
5 TRCN0000000520 CATCGCACACTTTGACCTGAA pLKO.1 540 CDS 100% 4.050 2.835 N DAPK3 n/a
6 TRCN0000421278 TTTCGACTTCCTGGCCGAGAA pLKO_005 441 CDS 100% 4.050 2.835 N Dapk3 n/a
7 TRCN0000024244 CCCAACATCATAACACTGCAT pLKO.1 358 CDS 100% 2.640 1.848 N Dapk3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14610 pDONR223 100% 80% 39.5% None (many diffs) n/a
2 ccsbBroad304_14610 pLX_304 0% 80% 39.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000468144 TACAGTGCAGAGCATGATATCCCG pLX_317 28.6% 80% 39.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV