Transcript: Mouse XM_006513283.3

PREDICTED: Mus musculus lanosterol synthase (Lss), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lss (16987)
Length:
1843
CDS:
97..1773

Additional Resources:

NCBI RefSeq record:
XM_006513283.3
NBCI Gene record:
Lss (16987)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513283.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075717 GCACTGAAGCATTTCCATGAA pLKO.1 1717 CDS 100% 4.950 3.960 N Lss n/a
2 TRCN0000325026 GCACTGAAGCATTTCCATGAA pLKO_005 1717 CDS 100% 4.950 3.960 N Lss n/a
3 TRCN0000075715 GCTCTCAGAATCCTGGGTATT pLKO.1 577 CDS 100% 10.800 7.560 N Lss n/a
4 TRCN0000325023 GCTCTCAGAATCCTGGGTATT pLKO_005 577 CDS 100% 10.800 7.560 N Lss n/a
5 TRCN0000075716 CCCGATCTCAAAGACCATCAA pLKO.1 1107 CDS 100% 4.950 3.465 N Lss n/a
6 TRCN0000325025 CCCGATCTCAAAGACCATCAA pLKO_005 1107 CDS 100% 4.950 3.465 N Lss n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513283.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06539 pDONR223 100% 63.3% 65% None (many diffs) n/a
2 ccsbBroad304_06539 pLX_304 0% 63.3% 65% V5 (many diffs) n/a
3 TRCN0000469759 ACGTGGAAGTGGTCTCTTTCGTCC pLX_317 19% 63.3% 65% V5 (many diffs) n/a
Download CSV