Transcript: Mouse XM_006513447.1

PREDICTED: Mus musculus synaptotagmin I (Syt1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Syt1 (20979)
Length:
4303
CDS:
148..1413

Additional Resources:

NCBI RefSeq record:
XM_006513447.1
NBCI Gene record:
Syt1 (20979)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513447.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093254 CCTCAGTAATATGGGTCCTTT pLKO.1 1476 3UTR 100% 4.950 6.930 N Syt1 n/a
2 TRCN0000053857 GCAAAGTCTTTGTGGGCTACA pLKO.1 1268 CDS 100% 4.050 5.670 N SYT1 n/a
3 TRCN0000093255 GCCTTAATTGCCATAGCCATA pLKO.1 322 CDS 100% 4.050 5.670 N Syt1 n/a
4 TRCN0000093256 GCTTCAATATTCACTGGACTA pLKO.1 579 CDS 100% 4.050 3.240 N Syt1 n/a
5 TRCN0000093257 CAGTCTTCAATGAACAGTTTA pLKO.1 758 CDS 100% 13.200 9.240 N Syt1 n/a
6 TRCN0000379704 GGGAGGGAAGAACGCCATTAA pLKO_005 432 CDS 100% 13.200 9.240 N Syt1 n/a
7 TRCN0000380502 ATGAAGGATCAGGCCCTTAAG pLKO_005 484 CDS 100% 10.800 7.560 N Syt1 n/a
8 TRCN0000381596 CATCTGATCCATACGTCAAAG pLKO_005 674 CDS 100% 10.800 7.560 N Syt1 n/a
9 TRCN0000380868 CCATGCATTCCTGATACAATC pLKO_005 1507 3UTR 100% 10.800 7.560 N Syt1 n/a
10 TRCN0000380921 TGAAGTTCCGTTCGAGCAAAT pLKO_005 1182 CDS 100% 10.800 7.560 N Syt1 n/a
11 TRCN0000093258 GAGCAAATCCAGAAAGTGCAA pLKO.1 1195 CDS 100% 2.640 1.848 N Syt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513447.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07026 pDONR223 100% 89.9% 97.6% None (many diffs) n/a
2 ccsbBroad304_07026 pLX_304 0% 89.9% 97.6% V5 (many diffs) n/a
3 TRCN0000466284 TTCCCATGAGACACGCAACATGTA pLX_317 26.8% 89.9% 97.6% V5 (many diffs) n/a
Download CSV