Transcript: Mouse XM_006513510.2

PREDICTED: Mus musculus adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2 (Appl2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Appl2 (216190)
Length:
2875
CDS:
172..2001

Additional Resources:

NCBI RefSeq record:
XM_006513510.2
NBCI Gene record:
Appl2 (216190)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375876 GGCTTCTTGTCATCCGTTAAA pLKO_005 682 CDS 100% 13.200 18.480 N Appl2 n/a
2 TRCN0000376823 TTCAGGCGGTGACGCCAATTA pLKO_005 1196 CDS 100% 13.200 18.480 N Appl2 n/a
3 TRCN0000217861 GTCAAACTCTGAGGTTGATAG pLKO.1 1628 CDS 100% 10.800 8.640 N Appl2 n/a
4 TRCN0000366945 AGAAGCACTGGCTCGATTAAT pLKO_005 1872 CDS 100% 15.000 10.500 N Appl2 n/a
5 TRCN0000366893 CAGTGGCAAACCGGGAATAAT pLKO_005 1053 CDS 100% 15.000 10.500 N Appl2 n/a
6 TRCN0000375940 GAGAAGGCGAAGACGGAAATT pLKO_005 481 CDS 100% 13.200 9.240 N Appl2 n/a
7 TRCN0000200411 GCGTGCCTACACTCTACAAAT pLKO.1 2184 3UTR 100% 13.200 9.240 N Appl2 n/a
8 TRCN0000200043 CCTTCCTCAAAGGGACCAATT pLKO.1 2641 3UTR 100% 10.800 7.560 N Appl2 n/a
9 TRCN0000375939 GAATTTAGAACACCGACAATC pLKO_005 2093 3UTR 100% 10.800 7.560 N Appl2 n/a
10 TRCN0000176873 GCGATGAAGAAGTAATTTCAA pLKO.1 245 CDS 100% 5.625 3.938 N Appl2 n/a
11 TRCN0000182426 GCTCCCTAAGAAGAAGGAGAA pLKO.1 459 CDS 100% 4.050 2.835 N Appl2 n/a
12 TRCN0000200320 GCAGATGTTCATCGTTCGGTT pLKO.1 1479 CDS 100% 2.640 1.848 N Appl2 n/a
13 TRCN0000181227 CCTGAAACAGAGGAACTGATT pLKO.1 1318 CDS 100% 4.950 2.970 N Appl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08489 pDONR223 100% 80.4% 84.4% None (many diffs) n/a
2 ccsbBroad304_08489 pLX_304 0% 80.4% 84.4% V5 (many diffs) n/a
3 TRCN0000481225 AGTAGTAGCAGAAGGTTCGGATTC pLX_317 18.7% 80.4% 84.4% V5 (many diffs) n/a
Download CSV